Incidental Mutation 'RF010:Ankrd28'
ID603152
Institutional Source Beutler Lab
Gene Symbol Ankrd28
Ensembl Gene ENSMUSG00000014496
Gene Nameankyrin repeat domain 28
SynonymsE430019N21Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.290) question?
Stock #RF010 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location31698768-31830651 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31778986 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 16 (I16T)
Ref Sequence ENSEMBL: ENSMUSP00000014640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014640] [ENSMUST00000227089] [ENSMUST00000227863] [ENSMUST00000228037]
Predicted Effect probably damaging
Transcript: ENSMUST00000014640
AA Change: I16T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000014640
Gene: ENSMUSG00000014496
AA Change: I16T

DomainStartEndE-ValueType
ANK 7 36 5.69e2 SMART
ANK 40 69 2.45e-4 SMART
ANK 73 102 1.59e-3 SMART
ANK 106 135 1.09e-1 SMART
ANK 139 168 1.58e-7 SMART
ANK 172 201 4.97e-5 SMART
ANK 205 234 1.01e-5 SMART
ANK 238 267 2.74e-7 SMART
ANK 271 301 4.13e-2 SMART
ANK 305 334 3.8e-1 SMART
ANK 338 367 3.06e-5 SMART
ANK 371 400 1.44e-1 SMART
ANK 404 433 6.76e-7 SMART
ANK 437 466 1.73e-4 SMART
ANK 470 500 7.83e-3 SMART
ANK 504 534 2.99e1 SMART
ANK 549 578 1.34e-1 SMART
ANK 582 611 3.76e-5 SMART
ANK 616 645 4.13e-2 SMART
ANK 652 681 1.24e-5 SMART
ANK 685 714 4.5e-3 SMART
ANK 718 747 1.93e-2 SMART
ANK 755 784 2.85e-5 SMART
ANK 787 818 2.15e0 SMART
ANK 822 851 2.16e-5 SMART
ANK 855 885 4.5e-3 SMART
ANK 889 918 6.61e-1 SMART
ANK 925 954 3.85e-2 SMART
low complexity region 982 995 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000227089
Predicted Effect probably damaging
Transcript: ENSMUST00000227863
AA Change: I46T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000228037
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik GGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG GGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG 17: 35,568,576 probably benign Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,905,096 probably benign Het
AY761185 GCACTGTGGGC G 8: 20,943,911 probably null Het
B020031M17Rik A T 13: 119,950,046 V8E probably benign Het
Bend3 T A 10: 43,510,184 F191Y possibly damaging Het
Calhm1 GTGGC GTGGCTGTGGCTATGGC 19: 47,141,273 probably benign Het
Camkv CGCTGCTGC CGC 9: 107,947,860 probably benign Het
Chga GCA GCATCA 12: 102,561,403 probably benign Het
Cngb1 CTCTGGCTCTGGCTCTGGCTCTG C 8: 95,303,650 probably null Het
Cnot3 T C 7: 3,656,069 V438A probably benign Het
Cntnap5c T A 17: 58,286,795 W710R probably damaging Het
Dyrk1a A G 16: 94,677,563 S404G probably benign Het
Efhd2 GCCGCC GCCGCCTCCGCC 4: 141,874,764 probably benign Het
Flywch1 GTGT GTGTGGGGAGGCTACGTACTCACCCACACCTGTTGT 17: 23,762,175 probably null Het
Fmn2 T A 1: 174,582,015 S605T unknown Het
Gab3 TCT TCTGCT X: 75,000,011 probably benign Het
Gabre GCTC GCTCCGTCTC X: 72,270,060 probably benign Het
Gli3 A G 13: 15,726,369 Y1447C probably damaging Het
Hibch T C 1: 52,913,732 V297A probably benign Het
Ifi213 C G 1: 173,582,153 D462H probably damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Lce1m GCTGCTGCC GCTGCTGCCCCCACTGCTGCC 3: 93,018,290 probably benign Het
Lpo A G 11: 87,821,102 V43A probably benign Het
Map1a A AGCTCCAGCTCCAGCCCCACCTCCAGCTCCC 2: 121,306,318 probably benign Het
Mapk9 A G 11: 49,854,256 probably benign Het
Mep1a G A 17: 43,486,235 H314Y probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myh3 AC ACTTCC 11: 67,086,359 probably null Het
Nusap1 ACGTTAGCAGTGAGGAGCAA ACGTTAGCAGTGAGGAGCAAACTGAGATACTCGTTAGCAGTGAGGAGCAA 2: 119,627,584 probably benign Het
Olfr1118 T A 2: 87,308,840 V37E possibly damaging Het
Olfr305 T C 7: 86,363,386 Q317R probably benign Het
Pdcd11 AGGAGG A 19: 47,113,451 probably null Het
Pfkm T A 15: 98,129,793 I651N possibly damaging Het
Phldb3 CCCCCGCCCC CCCCC 7: 24,626,495 probably null Het
Prkce T C 17: 86,488,199 V288A probably damaging Het
Pxmp4 A G 2: 154,592,263 S93P probably damaging Het
Rfc4 T C 16: 23,127,482 T17A probably benign Het
Rfx4 CTCTCTCT CTCTCTCTCTCTCTCTATCTCTCT 10: 84,858,487 probably benign Het
Ryr3 G T 2: 112,775,670 A2415E probably damaging Het
Sbp ACAAAGATGCTGACAACAAAGATGCTGACA ACAAAGATGCTGACACCAAAGATGCTGACAACAAAGATGCTGACA 17: 23,945,351 probably benign Het
Sec24c T A 14: 20,688,715 probably null Het
Sec63 C A 10: 42,806,624 A437E probably benign Het
Six3 GCG GCGTCG 17: 85,621,355 probably benign Het
Slco5a1 G A 1: 12,871,947 T825I probably damaging Het
Stard8 GGA GGAAGA X: 99,066,517 probably benign Het
Stxbp1 A G 2: 32,821,915 V30A probably benign Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,727,662 probably benign Het
Syne1 T A 10: 5,246,386 D3882V possibly damaging Het
T A G 17: 8,441,708 T384A probably benign Het
Tbc1d12 CGGGGCGG CG 19: 38,836,940 probably benign Het
Tcof1 CAG CAGAAG 18: 60,835,744 probably benign Het
Tfeb GCA GCAACA 17: 47,786,094 probably benign Het
Tfeb CAG CAGAAG 17: 47,786,107 probably benign Het
Thegl CAG CAGCGATCCTCCCCAGTCCCGCAAGGCGAG 5: 77,016,427 probably benign Het
Thumpd3 C T 6: 113,056,045 A248V probably damaging Het
Tmem181a T C 17: 6,280,703 probably null Het
Tmem56 T A 3: 121,228,884 I103L probably benign Het
Trim41 A T 11: 48,807,338 H600Q probably damaging Het
Ttbk2 A T 2: 120,790,339 C147* probably null Het
Ttll2 C T 17: 7,351,338 A397T probably benign Het
Unc79 T A 12: 103,112,787 L1737Q probably benign Het
Usp47 T A 7: 112,092,938 V869E probably damaging Het
Vmn1r231 T A 17: 20,889,993 Q220L probably damaging Het
Vmn2r26 C T 6: 124,039,489 T304I possibly damaging Het
Wdr66 TCTCA T 5: 123,274,161 probably benign Het
Wrn T C 8: 33,288,765 N839S probably benign Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,036,471 probably benign Het
Zfp384 GGCCCAGG GGCCCAGGAGCACGCCCAGG 6: 125,036,488 probably benign Het
Zfyve26 C T 12: 79,255,338 C1828Y probably damaging Het
Znrd1as CACCACCAC CACCACCACCACCACCACCACTACCACCAC 17: 36,965,063 probably benign Het
Other mutations in Ankrd28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Ankrd28 APN 14 31743365 missense possibly damaging 0.94
IGL01335:Ankrd28 APN 14 31702024 missense probably damaging 0.99
IGL01564:Ankrd28 APN 14 31755767 missense probably damaging 1.00
IGL01624:Ankrd28 APN 14 31710857 missense probably benign 0.00
IGL01987:Ankrd28 APN 14 31778974 missense probably damaging 1.00
IGL02100:Ankrd28 APN 14 31727625 unclassified probably benign
IGL02307:Ankrd28 APN 14 31733708 missense probably damaging 1.00
IGL02656:Ankrd28 APN 14 31702240 missense possibly damaging 0.94
IGL03069:Ankrd28 APN 14 31755786 nonsense probably null
R0038:Ankrd28 UTSW 14 31708035 missense probably damaging 0.99
R0038:Ankrd28 UTSW 14 31708035 missense probably damaging 0.99
R0124:Ankrd28 UTSW 14 31727741 missense probably damaging 1.00
R0347:Ankrd28 UTSW 14 31702022 makesense probably null
R0452:Ankrd28 UTSW 14 31748738 missense probably damaging 1.00
R0685:Ankrd28 UTSW 14 31743450 unclassified probably benign
R0751:Ankrd28 UTSW 14 31764268 missense probably damaging 1.00
R1349:Ankrd28 UTSW 14 31745261 missense probably benign 0.05
R1372:Ankrd28 UTSW 14 31745261 missense probably benign 0.05
R1695:Ankrd28 UTSW 14 31707244 missense probably damaging 1.00
R1888:Ankrd28 UTSW 14 31732025 splice site probably benign
R1938:Ankrd28 UTSW 14 31705276 missense possibly damaging 0.74
R2001:Ankrd28 UTSW 14 31745336 missense possibly damaging 0.94
R2162:Ankrd28 UTSW 14 31708762 missense probably damaging 1.00
R2352:Ankrd28 UTSW 14 31710947 missense probably benign 0.05
R2357:Ankrd28 UTSW 14 31764294 nonsense probably null
R3545:Ankrd28 UTSW 14 31715260 missense probably benign 0.13
R3548:Ankrd28 UTSW 14 31715260 missense probably benign 0.13
R3710:Ankrd28 UTSW 14 31748851 splice site probably benign
R4282:Ankrd28 UTSW 14 31745225 missense possibly damaging 0.74
R4501:Ankrd28 UTSW 14 31706796 missense probably damaging 0.97
R4513:Ankrd28 UTSW 14 31743285 missense probably damaging 1.00
R4658:Ankrd28 UTSW 14 31710868 missense probably damaging 1.00
R4731:Ankrd28 UTSW 14 31755741 missense probably benign 0.43
R4732:Ankrd28 UTSW 14 31755741 missense probably benign 0.43
R4733:Ankrd28 UTSW 14 31755741 missense probably benign 0.43
R4776:Ankrd28 UTSW 14 31732054 missense probably damaging 1.00
R4801:Ankrd28 UTSW 14 31736830 missense probably damaging 1.00
R4802:Ankrd28 UTSW 14 31736830 missense probably damaging 1.00
R5279:Ankrd28 UTSW 14 31735006 missense probably damaging 0.99
R5633:Ankrd28 UTSW 14 31735065 missense probably damaging 1.00
R5809:Ankrd28 UTSW 14 31743354 missense probably benign 0.19
R5959:Ankrd28 UTSW 14 31729922 missense probably benign 0.16
R6228:Ankrd28 UTSW 14 31707220 missense probably damaging 1.00
R6358:Ankrd28 UTSW 14 31710864 missense probably damaging 1.00
R6533:Ankrd28 UTSW 14 31732084 missense possibly damaging 0.49
R6598:Ankrd28 UTSW 14 31708939 missense probably damaging 1.00
R6822:Ankrd28 UTSW 14 31736840 critical splice acceptor site probably null
R7352:Ankrd28 UTSW 14 31708041 missense probably damaging 1.00
R7396:Ankrd28 UTSW 14 31702202 missense probably benign 0.00
R7462:Ankrd28 UTSW 14 31778929 missense probably benign 0.40
R7517:Ankrd28 UTSW 14 31715374 missense possibly damaging 0.65
R7629:Ankrd28 UTSW 14 31715264 missense probably benign 0.00
R7783:Ankrd28 UTSW 14 31706813 missense probably damaging 0.99
R7981:Ankrd28 UTSW 14 31702157 missense probably benign 0.08
R8401:Ankrd28 UTSW 14 31745294 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTGAGACTCTCCTGCCTTC -3'
(R):5'- CCAGGATGAACCCTATACTTTGATATG -3'

Sequencing Primer
(F):5'- GCCTTCTCTAAAAACAACTGTTGCAG -3'
(R):5'- CCCTATACTTTGATATGATTAGGCTG -3'
Posted On2019-12-04