Incidental Mutation 'RF010:Pfkm'
ID603153
Institutional Source Beutler Lab
Gene Symbol Pfkm
Ensembl Gene ENSMUSG00000033065
Gene Namephosphofructokinase, muscle
SynonymsPFK-M, Pfk-4, PFK-A, Pfk4, Pfkx
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.790) question?
Stock #RF010 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location98092589-98132451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 98129793 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 651 (I651N)
Ref Sequence ENSEMBL: ENSMUSP00000059801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051226] [ENSMUST00000143400] [ENSMUST00000163507] [ENSMUST00000230445]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051226
AA Change: I651N

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000059801
Gene: ENSMUSG00000033065
AA Change: I651N

DomainStartEndE-ValueType
Pfam:PFK 17 324 1.3e-111 PFAM
Pfam:PFK 402 687 1e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143400
SMART Domains Protein: ENSMUSP00000115813
Gene: ENSMUSG00000048175

DomainStartEndE-ValueType
Blast:ANK 20 49 5e-13 BLAST
ANK 52 81 4.5e-3 SMART
ANK 85 113 1.22e-4 SMART
ANK 117 146 1.81e-7 SMART
ANK 150 179 2.45e-4 SMART
SOCS_box 247 287 2.08e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000163507
AA Change: I651N

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132803
Gene: ENSMUSG00000033065
AA Change: I651N

DomainStartEndE-ValueType
Pfam:PFK 16 326 2.9e-138 PFAM
Pfam:PFK 401 688 1.8e-61 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000230445
AA Change: I651N

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Three phosphofructokinase isozymes exist in humans: muscle, liver and platelet. These isozymes function as subunits of the mammalian tetramer phosphofructokinase, which catalyzes the phosphorylation of fructose-6-phosphate to fructose-1,6-bisphosphate. Tetramer composition varies depending on tissue type. This gene encodes the muscle-type isozyme. Mutations in this gene have been associated with glycogen storage disease type VII, also known as Tarui disease. Alternatively spliced transcript variants have been described.[provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit abnormal glucose homeostasis. Mice homozygous for a knock-out allele exhibit premature death, exercise intolerance, abnormal glucose homeostasis, cardiomegaly, splenomegaly, and abnormal muscle morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik GGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG GGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG 17: 35,568,576 probably benign Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,905,096 probably benign Het
Ankrd28 A G 14: 31,778,986 I16T probably damaging Het
AY761185 GCACTGTGGGC G 8: 20,943,911 probably null Het
B020031M17Rik A T 13: 119,950,046 V8E probably benign Het
Bend3 T A 10: 43,510,184 F191Y possibly damaging Het
Calhm1 GTGGC GTGGCTGTGGCTATGGC 19: 47,141,273 probably benign Het
Camkv CGCTGCTGC CGC 9: 107,947,860 probably benign Het
Chga GCA GCATCA 12: 102,561,403 probably benign Het
Cngb1 CTCTGGCTCTGGCTCTGGCTCTG C 8: 95,303,650 probably null Het
Cnot3 T C 7: 3,656,069 V438A probably benign Het
Cntnap5c T A 17: 58,286,795 W710R probably damaging Het
Dyrk1a A G 16: 94,677,563 S404G probably benign Het
Efhd2 GCCGCC GCCGCCTCCGCC 4: 141,874,764 probably benign Het
Flywch1 GTGT GTGTGGGGAGGCTACGTACTCACCCACACCTGTTGT 17: 23,762,175 probably null Het
Fmn2 T A 1: 174,582,015 S605T unknown Het
Gab3 TCT TCTGCT X: 75,000,011 probably benign Het
Gabre GCTC GCTCCGTCTC X: 72,270,060 probably benign Het
Gli3 A G 13: 15,726,369 Y1447C probably damaging Het
Hibch T C 1: 52,913,732 V297A probably benign Het
Ifi213 C G 1: 173,582,153 D462H probably damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Lce1m GCTGCTGCC GCTGCTGCCCCCACTGCTGCC 3: 93,018,290 probably benign Het
Lpo A G 11: 87,821,102 V43A probably benign Het
Map1a A AGCTCCAGCTCCAGCCCCACCTCCAGCTCCC 2: 121,306,318 probably benign Het
Mapk9 A G 11: 49,854,256 probably benign Het
Mep1a G A 17: 43,486,235 H314Y probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myh3 AC ACTTCC 11: 67,086,359 probably null Het
Nusap1 ACGTTAGCAGTGAGGAGCAA ACGTTAGCAGTGAGGAGCAAACTGAGATACTCGTTAGCAGTGAGGAGCAA 2: 119,627,584 probably benign Het
Olfr1118 T A 2: 87,308,840 V37E possibly damaging Het
Olfr305 T C 7: 86,363,386 Q317R probably benign Het
Pdcd11 AGGAGG A 19: 47,113,451 probably null Het
Phldb3 CCCCCGCCCC CCCCC 7: 24,626,495 probably null Het
Prkce T C 17: 86,488,199 V288A probably damaging Het
Pxmp4 A G 2: 154,592,263 S93P probably damaging Het
Rfc4 T C 16: 23,127,482 T17A probably benign Het
Rfx4 CTCTCTCT CTCTCTCTCTCTCTCTATCTCTCT 10: 84,858,487 probably benign Het
Ryr3 G T 2: 112,775,670 A2415E probably damaging Het
Sbp ACAAAGATGCTGACAACAAAGATGCTGACA ACAAAGATGCTGACACCAAAGATGCTGACAACAAAGATGCTGACA 17: 23,945,351 probably benign Het
Sec24c T A 14: 20,688,715 probably null Het
Sec63 C A 10: 42,806,624 A437E probably benign Het
Six3 GCG GCGTCG 17: 85,621,355 probably benign Het
Slco5a1 G A 1: 12,871,947 T825I probably damaging Het
Stard8 GGA GGAAGA X: 99,066,517 probably benign Het
Stxbp1 A G 2: 32,821,915 V30A probably benign Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,727,662 probably benign Het
Syne1 T A 10: 5,246,386 D3882V possibly damaging Het
T A G 17: 8,441,708 T384A probably benign Het
Tbc1d12 CGGGGCGG CG 19: 38,836,940 probably benign Het
Tcof1 CAG CAGAAG 18: 60,835,744 probably benign Het
Tfeb GCA GCAACA 17: 47,786,094 probably benign Het
Tfeb CAG CAGAAG 17: 47,786,107 probably benign Het
Thegl CAG CAGCGATCCTCCCCAGTCCCGCAAGGCGAG 5: 77,016,427 probably benign Het
Thumpd3 C T 6: 113,056,045 A248V probably damaging Het
Tmem181a T C 17: 6,280,703 probably null Het
Tmem56 T A 3: 121,228,884 I103L probably benign Het
Trim41 A T 11: 48,807,338 H600Q probably damaging Het
Ttbk2 A T 2: 120,790,339 C147* probably null Het
Ttll2 C T 17: 7,351,338 A397T probably benign Het
Unc79 T A 12: 103,112,787 L1737Q probably benign Het
Usp47 T A 7: 112,092,938 V869E probably damaging Het
Vmn1r231 T A 17: 20,889,993 Q220L probably damaging Het
Vmn2r26 C T 6: 124,039,489 T304I possibly damaging Het
Wdr66 TCTCA T 5: 123,274,161 probably benign Het
Wrn T C 8: 33,288,765 N839S probably benign Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,036,471 probably benign Het
Zfp384 GGCCCAGG GGCCCAGGAGCACGCCCAGG 6: 125,036,488 probably benign Het
Zfyve26 C T 12: 79,255,338 C1828Y probably damaging Het
Znrd1as CACCACCAC CACCACCACCACCACCACCACTACCACCAC 17: 36,965,063 probably benign Het
Other mutations in Pfkm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Pfkm APN 15 98125594 missense probably benign 0.00
IGL01843:Pfkm APN 15 98129306 missense possibly damaging 0.65
IGL02090:Pfkm APN 15 98123240 critical splice donor site probably null
IGL02624:Pfkm APN 15 98126395 missense probably benign 0.03
IGL02869:Pfkm APN 15 98128242 missense probably damaging 1.00
IGL03102:Pfkm APN 15 98126385 missense possibly damaging 0.86
IGL03164:Pfkm APN 15 98131962 missense probably damaging 1.00
IGL03188:Pfkm APN 15 98123243 splice site probably null
IGL03241:Pfkm APN 15 98123180 missense probably benign 0.02
E0374:Pfkm UTSW 15 98123233 missense probably damaging 1.00
R0379:Pfkm UTSW 15 98126314 missense probably benign 0.01
R0524:Pfkm UTSW 15 98131607 missense probably benign
R0898:Pfkm UTSW 15 98128230 missense probably benign 0.09
R1086:Pfkm UTSW 15 98131665 missense probably benign 0.05
R1698:Pfkm UTSW 15 98128318 missense possibly damaging 0.95
R1886:Pfkm UTSW 15 98127746 missense probably damaging 1.00
R2051:Pfkm UTSW 15 98131692 missense probably benign 0.03
R2102:Pfkm UTSW 15 98129290 missense probably damaging 1.00
R2312:Pfkm UTSW 15 98125575 missense probably damaging 1.00
R3154:Pfkm UTSW 15 98118209 missense probably damaging 1.00
R3688:Pfkm UTSW 15 98131517 missense probably benign 0.00
R3911:Pfkm UTSW 15 98125047 missense probably benign 0.02
R4999:Pfkm UTSW 15 98128242 missense probably damaging 1.00
R5008:Pfkm UTSW 15 98122689 missense probably benign 0.35
R5027:Pfkm UTSW 15 98119426 missense possibly damaging 0.55
R5178:Pfkm UTSW 15 98131515 missense probably benign
R5617:Pfkm UTSW 15 98122226 missense possibly damaging 0.88
R5891:Pfkm UTSW 15 98122690 nonsense probably null
R6248:Pfkm UTSW 15 98126379 missense probably damaging 1.00
R7079:Pfkm UTSW 15 98095082 missense probably benign 0.31
R7605:Pfkm UTSW 15 98121310 missense probably damaging 1.00
R7979:Pfkm UTSW 15 98128236 missense probably damaging 1.00
X0020:Pfkm UTSW 15 98112226 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGGAGGAGATAAAACAGCTTTC -3'
(R):5'- GTCTAAGACAAGTTGTGATGTGATG -3'

Sequencing Primer
(F):5'- AGGGACAGACTCCTACTTCTG -3'
(R):5'- TGTGATGTGATGACCCAACC -3'
Posted On2019-12-04