Incidental Mutation 'RF010:Dyrk1a'
Institutional Source Beutler Lab
Gene Symbol Dyrk1a
Ensembl Gene ENSMUSG00000022897
Gene Namedual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1a
SynonymsD16Ertd493e, Mnbh, 2310043O08Rik, D16Ertd272e, Dyrk
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF010 (G1)
Quality Score225.009
Status Not validated
Chromosomal Location94570010-94695517 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94677563 bp
Amino Acid Change Serine to Glycine at position 404 (S404G)
Ref Sequence ENSEMBL: ENSMUSP00000023614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023614] [ENSMUST00000119878] [ENSMUST00000122284]
Predicted Effect probably benign
Transcript: ENSMUST00000023614
AA Change: S404G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023614
Gene: ENSMUSG00000022897
AA Change: S404G

low complexity region 136 147 N/A INTRINSIC
S_TKc 159 479 6.63e-79 SMART
low complexity region 502 525 N/A INTRINSIC
low complexity region 599 620 N/A INTRINSIC
low complexity region 650 672 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119878
AA Change: S404G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113660
Gene: ENSMUSG00000022897
AA Change: S404G

low complexity region 136 147 N/A INTRINSIC
S_TKc 159 479 6.63e-79 SMART
low complexity region 502 525 N/A INTRINSIC
low complexity region 599 620 N/A INTRINSIC
low complexity region 650 672 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122284
AA Change: S366G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112853
Gene: ENSMUSG00000022897
AA Change: S366G

low complexity region 127 138 N/A INTRINSIC
S_TKc 150 470 6.63e-79 SMART
low complexity region 493 516 N/A INTRINSIC
low complexity region 590 611 N/A INTRINSIC
low complexity region 641 663 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Dual-specificity tyrosine phosphorylation-regulated kinase (DYRK) family. This member contains a nuclear targeting signal sequence, a protein kinase domain, a leucine zipper motif, and a highly conservative 13-consecutive-histidine repeat. It catalyzes its autophosphorylation on serine/threonine and tyrosine residues. It may play a significant role in a signaling pathway regulating cell proliferation and may be involved in brain development. This gene is a homolog of Drosophila mnb (minibrain) gene and rat Dyrk gene. It is localized in the Down syndrome critical region of chromosome 21, and is considered to be a strong candidate gene for learning defects associated with Down syndrome. Alternative splicing of this gene generates several transcript variants differing from each other either in the 5' UTR or in the 3' coding region. These variants encode at least five different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted deletion present a general embryonic growth delay and die during midgestation. Heterozygotes display reduced postnatal survival, postnatal growth retardation, microcephaly, behavioral and motor deficits, and altered neocortical pyramidal cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd28 A G 14: 31,778,986 I16T probably damaging Het
AY761185 GCACTGTGGGC G 8: 20,943,911 probably null Het
B020031M17Rik A T 13: 119,950,046 V8E probably benign Het
Bend3 T A 10: 43,510,184 F191Y possibly damaging Het
Calhm1 GTGGC GTGGCTGTGGCTATGGC 19: 47,141,273 probably benign Het
Camkv CGCTGCTGC CGC 9: 107,947,860 probably benign Het
Chga GCA GCATCA 12: 102,561,403 probably benign Het
Cngb1 CTCTGGCTCTGGCTCTGGCTCTG C 8: 95,303,650 probably null Het
Cnot3 T C 7: 3,656,069 V438A probably benign Het
Cntnap5c T A 17: 58,286,795 W710R probably damaging Het
Efhd2 GCCGCC GCCGCCTCCGCC 4: 141,874,764 probably benign Het
Fmn2 T A 1: 174,582,015 S605T unknown Het
Gab3 TCT TCTGCT X: 75,000,011 probably benign Het
Gabre GCTC GCTCCGTCTC X: 72,270,060 probably benign Het
Gli3 A G 13: 15,726,369 Y1447C probably damaging Het
Hibch T C 1: 52,913,732 V297A probably benign Het
Ifi213 C G 1: 173,582,153 D462H probably damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Lce1m GCTGCTGCC GCTGCTGCCCCCACTGCTGCC 3: 93,018,290 probably benign Het
Lpo A G 11: 87,821,102 V43A probably benign Het
Map1a A AGCTCCAGCTCCAGCCCCACCTCCAGCTCCC 2: 121,306,318 probably benign Het
Mapk9 A G 11: 49,854,256 probably benign Het
Mep1a G A 17: 43,486,235 H314Y probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myh3 AC ACTTCC 11: 67,086,359 probably null Het
Olfr1118 T A 2: 87,308,840 V37E possibly damaging Het
Olfr305 T C 7: 86,363,386 Q317R probably benign Het
Pdcd11 AGGAGG A 19: 47,113,451 probably null Het
Pfkm T A 15: 98,129,793 I651N possibly damaging Het
Phldb3 CCCCCGCCCC CCCCC 7: 24,626,495 probably null Het
Prkce T C 17: 86,488,199 V288A probably damaging Het
Pxmp4 A G 2: 154,592,263 S93P probably damaging Het
Rfc4 T C 16: 23,127,482 T17A probably benign Het
Rfx4 CTCTCTCT CTCTCTCTCTCTCTCTATCTCTCT 10: 84,858,487 probably benign Het
Ryr3 G T 2: 112,775,670 A2415E probably damaging Het
Sec24c T A 14: 20,688,715 probably null Het
Sec63 C A 10: 42,806,624 A437E probably benign Het
Six3 GCG GCGTCG 17: 85,621,355 probably benign Het
Slco5a1 G A 1: 12,871,947 T825I probably damaging Het
Stard8 GGA GGAAGA X: 99,066,517 probably benign Het
Stxbp1 A G 2: 32,821,915 V30A probably benign Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,727,662 probably benign Het
Syne1 T A 10: 5,246,386 D3882V possibly damaging Het
T A G 17: 8,441,708 T384A probably benign Het
Tbc1d12 CGGGGCGG CG 19: 38,836,940 probably benign Het
Tcof1 CAG CAGAAG 18: 60,835,744 probably benign Het
Tfeb GCA GCAACA 17: 47,786,094 probably benign Het
Tfeb CAG CAGAAG 17: 47,786,107 probably benign Het
Thegl CAG CAGCGATCCTCCCCAGTCCCGCAAGGCGAG 5: 77,016,427 probably benign Het
Thumpd3 C T 6: 113,056,045 A248V probably damaging Het
Tmem181a T C 17: 6,280,703 probably null Het
Tmem56 T A 3: 121,228,884 I103L probably benign Het
Trim41 A T 11: 48,807,338 H600Q probably damaging Het
Ttbk2 A T 2: 120,790,339 C147* probably null Het
Ttll2 C T 17: 7,351,338 A397T probably benign Het
Unc79 T A 12: 103,112,787 L1737Q probably benign Het
Usp47 T A 7: 112,092,938 V869E probably damaging Het
Vmn1r231 T A 17: 20,889,993 Q220L probably damaging Het
Vmn2r26 C T 6: 124,039,489 T304I possibly damaging Het
Wdr66 TCTCA T 5: 123,274,161 probably benign Het
Wrn T C 8: 33,288,765 N839S probably benign Het
Zfp384 GGCCCAGG GGCCCAGGAGCACGCCCAGG 6: 125,036,488 probably benign Het
Zfyve26 C T 12: 79,255,338 C1828Y probably damaging Het
Znrd1as CACCACCAC CACCACCACCACCACCACCACTACCACCAC 17: 36,965,063 probably benign Het
Other mutations in Dyrk1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01443:Dyrk1a APN 16 94685084 missense probably benign 0.21
IGL01599:Dyrk1a APN 16 94691884 missense possibly damaging 0.94
IGL01809:Dyrk1a APN 16 94659617 missense probably benign 0.00
IGL02201:Dyrk1a APN 16 94692149 missense probably benign 0.05
IGL02345:Dyrk1a APN 16 94671362 missense possibly damaging 0.88
IGL02508:Dyrk1a APN 16 94685183 missense probably damaging 0.97
IGL02709:Dyrk1a APN 16 94685243 missense probably benign 0.08
IGL02713:Dyrk1a APN 16 94685345 splice site probably benign
R0414:Dyrk1a UTSW 16 94663842 missense probably damaging 1.00
R2107:Dyrk1a UTSW 16 94686527 missense probably damaging 1.00
R2394:Dyrk1a UTSW 16 94685132 missense probably benign 0.02
R3124:Dyrk1a UTSW 16 94668801 splice site probably benign
R3125:Dyrk1a UTSW 16 94668801 splice site probably benign
R3792:Dyrk1a UTSW 16 94685074 missense probably benign 0.31
R3963:Dyrk1a UTSW 16 94663746 missense probably benign 0.00
R4573:Dyrk1a UTSW 16 94692023 missense possibly damaging 0.90
R4652:Dyrk1a UTSW 16 94692065 missense probably benign 0.02
R4965:Dyrk1a UTSW 16 94691995 nonsense probably null
R5326:Dyrk1a UTSW 16 94686581 missense probably damaging 0.98
R5540:Dyrk1a UTSW 16 94685343 critical splice donor site probably null
R5593:Dyrk1a UTSW 16 94659583 missense possibly damaging 0.64
R6313:Dyrk1a UTSW 16 94659514 missense probably damaging 0.99
R6396:Dyrk1a UTSW 16 94671440 missense probably damaging 1.00
R6524:Dyrk1a UTSW 16 94685120 missense probably benign 0.02
R7036:Dyrk1a UTSW 16 94686568 missense probably benign 0.09
R7326:Dyrk1a UTSW 16 94692043 missense probably damaging 0.97
R7861:Dyrk1a UTSW 16 94691716 nonsense probably null
R7916:Dyrk1a UTSW 16 94673341 missense probably damaging 1.00
R8310:Dyrk1a UTSW 16 94691791 missense probably benign 0.02
Z1176:Dyrk1a UTSW 16 94691762 missense probably benign 0.06
Z1177:Dyrk1a UTSW 16 94691580 critical splice acceptor site probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04