Incidental Mutation 'RF010:Mep1a'
ID603164
Institutional Source Beutler Lab
Gene Symbol Mep1a
Ensembl Gene ENSMUSG00000023914
Gene Namemeprin 1 alpha
SynonymsMep-1a, meprin A alpha-subunit, Mep1, meprin alpha, Mep-1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF010 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location43474324-43502812 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 43486235 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 314 (H314Y)
Ref Sequence ENSEMBL: ENSMUSP00000024707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024707] [ENSMUST00000117137]
Predicted Effect probably damaging
Transcript: ENSMUST00000024707
AA Change: H314Y

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000024707
Gene: ENSMUSG00000023914
AA Change: H314Y

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
ZnMc 83 222 1.16e-41 SMART
MAM 276 445 5.38e-61 SMART
MATH 445 590 6.9e-17 SMART
EGF 687 724 1.35e-2 SMART
transmembrane domain 727 749 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117137
AA Change: H301Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113838
Gene: ENSMUSG00000023914
AA Change: H301Y

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
ZnMc 70 209 1.16e-41 SMART
MAM 263 432 5.38e-61 SMART
MATH 432 577 6.9e-17 SMART
EGF 674 711 1.35e-2 SMART
transmembrane domain 714 736 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased litter size, reduced LPS-induced renal injury and bladder inflammation, and increased susceptibility to sodium dextran sulfate-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik GGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG GGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG 17: 35,568,576 probably benign Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,905,096 probably benign Het
Ankrd28 A G 14: 31,778,986 I16T probably damaging Het
AY761185 GCACTGTGGGC G 8: 20,943,911 probably null Het
B020031M17Rik A T 13: 119,950,046 V8E probably benign Het
Bend3 T A 10: 43,510,184 F191Y possibly damaging Het
Calhm1 GTGGC GTGGCTGTGGCTATGGC 19: 47,141,273 probably benign Het
Camkv CGCTGCTGC CGC 9: 107,947,860 probably benign Het
Chga GCA GCATCA 12: 102,561,403 probably benign Het
Cngb1 CTCTGGCTCTGGCTCTGGCTCTG C 8: 95,303,650 probably null Het
Cnot3 T C 7: 3,656,069 V438A probably benign Het
Cntnap5c T A 17: 58,286,795 W710R probably damaging Het
Dyrk1a A G 16: 94,677,563 S404G probably benign Het
Efhd2 GCCGCC GCCGCCTCCGCC 4: 141,874,764 probably benign Het
Flywch1 GTGT GTGTGGGGAGGCTACGTACTCACCCACACCTGTTGT 17: 23,762,175 probably null Het
Fmn2 T A 1: 174,582,015 S605T unknown Het
Gab3 TCT TCTGCT X: 75,000,011 probably benign Het
Gabre GCTC GCTCCGTCTC X: 72,270,060 probably benign Het
Gli3 A G 13: 15,726,369 Y1447C probably damaging Het
Hibch T C 1: 52,913,732 V297A probably benign Het
Ifi213 C G 1: 173,582,153 D462H probably damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Lce1m GCTGCTGCC GCTGCTGCCCCCACTGCTGCC 3: 93,018,290 probably benign Het
Lpo A G 11: 87,821,102 V43A probably benign Het
Map1a A AGCTCCAGCTCCAGCCCCACCTCCAGCTCCC 2: 121,306,318 probably benign Het
Mapk9 A G 11: 49,854,256 probably benign Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myh3 AC ACTTCC 11: 67,086,359 probably null Het
Nusap1 ACGTTAGCAGTGAGGAGCAA ACGTTAGCAGTGAGGAGCAAACTGAGATACTCGTTAGCAGTGAGGAGCAA 2: 119,627,584 probably benign Het
Olfr1118 T A 2: 87,308,840 V37E possibly damaging Het
Olfr305 T C 7: 86,363,386 Q317R probably benign Het
Pdcd11 AGGAGG A 19: 47,113,451 probably null Het
Pfkm T A 15: 98,129,793 I651N possibly damaging Het
Phldb3 CCCCCGCCCC CCCCC 7: 24,626,495 probably null Het
Prkce T C 17: 86,488,199 V288A probably damaging Het
Pxmp4 A G 2: 154,592,263 S93P probably damaging Het
Rfc4 T C 16: 23,127,482 T17A probably benign Het
Rfx4 CTCTCTCT CTCTCTCTCTCTCTCTATCTCTCT 10: 84,858,487 probably benign Het
Ryr3 G T 2: 112,775,670 A2415E probably damaging Het
Sbp ACAAAGATGCTGACAACAAAGATGCTGACA ACAAAGATGCTGACACCAAAGATGCTGACAACAAAGATGCTGACA 17: 23,945,351 probably benign Het
Sec24c T A 14: 20,688,715 probably null Het
Sec63 C A 10: 42,806,624 A437E probably benign Het
Six3 GCG GCGTCG 17: 85,621,355 probably benign Het
Slco5a1 G A 1: 12,871,947 T825I probably damaging Het
Stard8 GGA GGAAGA X: 99,066,517 probably benign Het
Stxbp1 A G 2: 32,821,915 V30A probably benign Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,727,662 probably benign Het
Syne1 T A 10: 5,246,386 D3882V possibly damaging Het
T A G 17: 8,441,708 T384A probably benign Het
Tbc1d12 CGGGGCGG CG 19: 38,836,940 probably benign Het
Tcof1 CAG CAGAAG 18: 60,835,744 probably benign Het
Tfeb GCA GCAACA 17: 47,786,094 probably benign Het
Tfeb CAG CAGAAG 17: 47,786,107 probably benign Het
Thegl CAG CAGCGATCCTCCCCAGTCCCGCAAGGCGAG 5: 77,016,427 probably benign Het
Thumpd3 C T 6: 113,056,045 A248V probably damaging Het
Tmem181a T C 17: 6,280,703 probably null Het
Tmem56 T A 3: 121,228,884 I103L probably benign Het
Trim41 A T 11: 48,807,338 H600Q probably damaging Het
Ttbk2 A T 2: 120,790,339 C147* probably null Het
Ttll2 C T 17: 7,351,338 A397T probably benign Het
Unc79 T A 12: 103,112,787 L1737Q probably benign Het
Usp47 T A 7: 112,092,938 V869E probably damaging Het
Vmn1r231 T A 17: 20,889,993 Q220L probably damaging Het
Vmn2r26 C T 6: 124,039,489 T304I possibly damaging Het
Wdr66 TCTCA T 5: 123,274,161 probably benign Het
Wrn T C 8: 33,288,765 N839S probably benign Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,036,471 probably benign Het
Zfp384 GGCCCAGG GGCCCAGGAGCACGCCCAGG 6: 125,036,488 probably benign Het
Zfyve26 C T 12: 79,255,338 C1828Y probably damaging Het
Znrd1as CACCACCAC CACCACCACCACCACCACCACTACCACCAC 17: 36,965,063 probably benign Het
Other mutations in Mep1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Mep1a APN 17 43479084 missense probably benign 0.00
IGL02814:Mep1a APN 17 43477221 missense probably benign
IGL03000:Mep1a APN 17 43474990 missense probably benign
IGL03335:Mep1a APN 17 43477173 missense possibly damaging 0.63
IGL03410:Mep1a APN 17 43478095 splice site probably null
PIT4544001:Mep1a UTSW 17 43482287 missense probably damaging 1.00
R0127:Mep1a UTSW 17 43497886 splice site probably benign
R0306:Mep1a UTSW 17 43502643 splice site probably benign
R0329:Mep1a UTSW 17 43497898 critical splice donor site probably null
R0330:Mep1a UTSW 17 43497898 critical splice donor site probably null
R0358:Mep1a UTSW 17 43478950 missense possibly damaging 0.92
R0667:Mep1a UTSW 17 43478190 missense probably benign 0.06
R1101:Mep1a UTSW 17 43491693 missense probably benign 0.03
R1458:Mep1a UTSW 17 43491672 missense probably damaging 1.00
R1525:Mep1a UTSW 17 43491636 missense probably damaging 1.00
R1992:Mep1a UTSW 17 43502682 missense probably benign
R2014:Mep1a UTSW 17 43497906 missense probably benign 0.01
R2212:Mep1a UTSW 17 43477263 missense probably benign 0.02
R3946:Mep1a UTSW 17 43475041 nonsense probably null
R4400:Mep1a UTSW 17 43475006 missense possibly damaging 0.77
R4598:Mep1a UTSW 17 43491578 critical splice donor site probably null
R4616:Mep1a UTSW 17 43486241 missense possibly damaging 0.81
R4688:Mep1a UTSW 17 43482248 missense possibly damaging 0.89
R5085:Mep1a UTSW 17 43478144 missense probably damaging 0.99
R5355:Mep1a UTSW 17 43477146 missense probably damaging 0.98
R5832:Mep1a UTSW 17 43478164 missense probably benign 0.27
R5833:Mep1a UTSW 17 43478164 missense probably benign 0.27
R5834:Mep1a UTSW 17 43478164 missense probably benign 0.27
R5835:Mep1a UTSW 17 43478164 missense probably benign 0.27
R6280:Mep1a UTSW 17 43502392 missense probably damaging 1.00
R6340:Mep1a UTSW 17 43479058 missense probably benign 0.00
R6340:Mep1a UTSW 17 43479233 missense probably benign 0.00
R6934:Mep1a UTSW 17 43482230 missense probably damaging 0.99
R7247:Mep1a UTSW 17 43475104 missense possibly damaging 0.67
R7660:Mep1a UTSW 17 43478977 missense probably benign 0.29
R7685:Mep1a UTSW 17 43479174 missense probably benign 0.00
R7703:Mep1a UTSW 17 43478106 missense possibly damaging 0.69
R7871:Mep1a UTSW 17 43479235 missense probably benign 0.33
R8131:Mep1a UTSW 17 43502667 missense probably benign 0.00
Z1088:Mep1a UTSW 17 43491596 missense probably damaging 1.00
Z1176:Mep1a UTSW 17 43477320 missense probably benign 0.08
Z1177:Mep1a UTSW 17 43486297 missense probably damaging 1.00
Z1177:Mep1a UTSW 17 43486306 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATTAAGGTTTCCTGCATGCAG -3'
(R):5'- ATGACAGTAAGGGCCTTTGGG -3'

Sequencing Primer
(F):5'- CACAGCATGGAGACTTTTTACTGAG -3'
(R):5'- GTGGCTTAAGACATTAACTCTTTGG -3'
Posted On2019-12-04