Incidental Mutation 'RF010:Cntnap5c'
ID603168
Institutional Source Beutler Lab
Gene Symbol Cntnap5c
Ensembl Gene ENSMUSG00000038048
Gene Namecontactin associated protein-like 5C
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #RF010 (G1)
Quality Score156.008
Status Not validated
Chromosome17
Chromosomal Location57769570-58410355 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58286795 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 710 (W710R)
Ref Sequence ENSEMBL: ENSMUSP00000075416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076038]
Predicted Effect probably damaging
Transcript: ENSMUST00000076038
AA Change: W710R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075416
Gene: ENSMUSG00000038048
AA Change: W710R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
FA58C 29 174 1.26e-10 SMART
LamG 201 338 1.57e-29 SMART
LamG 387 521 3e-26 SMART
EGF 549 583 1.88e-1 SMART
Blast:FBG 586 769 8e-83 BLAST
LamG 811 938 4.37e-28 SMART
EGF 959 995 6.55e-1 SMART
LamG 1036 1172 2.08e-11 SMART
transmembrane domain 1240 1262 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik GGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG GGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG 17: 35,568,576 probably benign Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,905,096 probably benign Het
Ankrd28 A G 14: 31,778,986 I16T probably damaging Het
AY761185 GCACTGTGGGC G 8: 20,943,911 probably null Het
B020031M17Rik A T 13: 119,950,046 V8E probably benign Het
Bend3 T A 10: 43,510,184 F191Y possibly damaging Het
Calhm1 GTGGC GTGGCTGTGGCTATGGC 19: 47,141,273 probably benign Het
Camkv CGCTGCTGC CGC 9: 107,947,860 probably benign Het
Chga GCA GCATCA 12: 102,561,403 probably benign Het
Cngb1 CTCTGGCTCTGGCTCTGGCTCTG C 8: 95,303,650 probably null Het
Cnot3 T C 7: 3,656,069 V438A probably benign Het
Dyrk1a A G 16: 94,677,563 S404G probably benign Het
Efhd2 GCCGCC GCCGCCTCCGCC 4: 141,874,764 probably benign Het
Flywch1 GTGT GTGTGGGGAGGCTACGTACTCACCCACACCTGTTGT 17: 23,762,175 probably null Het
Fmn2 T A 1: 174,582,015 S605T unknown Het
Gab3 TCT TCTGCT X: 75,000,011 probably benign Het
Gabre GCTC GCTCCGTCTC X: 72,270,060 probably benign Het
Gli3 A G 13: 15,726,369 Y1447C probably damaging Het
Hibch T C 1: 52,913,732 V297A probably benign Het
Ifi213 C G 1: 173,582,153 D462H probably damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Lce1m GCTGCTGCC GCTGCTGCCCCCACTGCTGCC 3: 93,018,290 probably benign Het
Lpo A G 11: 87,821,102 V43A probably benign Het
Map1a A AGCTCCAGCTCCAGCCCCACCTCCAGCTCCC 2: 121,306,318 probably benign Het
Mapk9 A G 11: 49,854,256 probably benign Het
Mep1a G A 17: 43,486,235 H314Y probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myh3 AC ACTTCC 11: 67,086,359 probably null Het
Nusap1 ACGTTAGCAGTGAGGAGCAA ACGTTAGCAGTGAGGAGCAAACTGAGATACTCGTTAGCAGTGAGGAGCAA 2: 119,627,584 probably benign Het
Olfr1118 T A 2: 87,308,840 V37E possibly damaging Het
Olfr305 T C 7: 86,363,386 Q317R probably benign Het
Pdcd11 AGGAGG A 19: 47,113,451 probably null Het
Pfkm T A 15: 98,129,793 I651N possibly damaging Het
Phldb3 CCCCCGCCCC CCCCC 7: 24,626,495 probably null Het
Prkce T C 17: 86,488,199 V288A probably damaging Het
Pxmp4 A G 2: 154,592,263 S93P probably damaging Het
Rfc4 T C 16: 23,127,482 T17A probably benign Het
Rfx4 CTCTCTCT CTCTCTCTCTCTCTCTATCTCTCT 10: 84,858,487 probably benign Het
Ryr3 G T 2: 112,775,670 A2415E probably damaging Het
Sbp ACAAAGATGCTGACAACAAAGATGCTGACA ACAAAGATGCTGACACCAAAGATGCTGACAACAAAGATGCTGACA 17: 23,945,351 probably benign Het
Sec24c T A 14: 20,688,715 probably null Het
Sec63 C A 10: 42,806,624 A437E probably benign Het
Six3 GCG GCGTCG 17: 85,621,355 probably benign Het
Slco5a1 G A 1: 12,871,947 T825I probably damaging Het
Stard8 GGA GGAAGA X: 99,066,517 probably benign Het
Stxbp1 A G 2: 32,821,915 V30A probably benign Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,727,662 probably benign Het
Syne1 T A 10: 5,246,386 D3882V possibly damaging Het
T A G 17: 8,441,708 T384A probably benign Het
Tbc1d12 CGGGGCGG CG 19: 38,836,940 probably benign Het
Tcof1 CAG CAGAAG 18: 60,835,744 probably benign Het
Tfeb GCA GCAACA 17: 47,786,094 probably benign Het
Tfeb CAG CAGAAG 17: 47,786,107 probably benign Het
Thegl CAG CAGCGATCCTCCCCAGTCCCGCAAGGCGAG 5: 77,016,427 probably benign Het
Thumpd3 C T 6: 113,056,045 A248V probably damaging Het
Tmem181a T C 17: 6,280,703 probably null Het
Tmem56 T A 3: 121,228,884 I103L probably benign Het
Trim41 A T 11: 48,807,338 H600Q probably damaging Het
Ttbk2 A T 2: 120,790,339 C147* probably null Het
Ttll2 C T 17: 7,351,338 A397T probably benign Het
Unc79 T A 12: 103,112,787 L1737Q probably benign Het
Usp47 T A 7: 112,092,938 V869E probably damaging Het
Vmn1r231 T A 17: 20,889,993 Q220L probably damaging Het
Vmn2r26 C T 6: 124,039,489 T304I possibly damaging Het
Wdr66 TCTCA T 5: 123,274,161 probably benign Het
Wrn T C 8: 33,288,765 N839S probably benign Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,036,471 probably benign Het
Zfp384 GGCCCAGG GGCCCAGGAGCACGCCCAGG 6: 125,036,488 probably benign Het
Zfyve26 C T 12: 79,255,338 C1828Y probably damaging Het
Znrd1as CACCACCAC CACCACCACCACCACCACCACTACCACCAC 17: 36,965,063 probably benign Het
Other mutations in Cntnap5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Cntnap5c APN 17 58162277 missense probably benign 0.00
IGL00543:Cntnap5c APN 17 58294350 missense probably benign
IGL00679:Cntnap5c APN 17 58055678 missense probably damaging 0.98
IGL00942:Cntnap5c APN 17 57769598 missense probably benign 0.03
IGL01352:Cntnap5c APN 17 58293901 missense probably benign 0.00
IGL01822:Cntnap5c APN 17 58055705 missense probably damaging 0.99
IGL01864:Cntnap5c APN 17 58410242 missense probably benign
IGL01922:Cntnap5c APN 17 58330119 missense possibly damaging 0.95
IGL02111:Cntnap5c APN 17 58102108 missense probably damaging 1.00
IGL02112:Cntnap5c APN 17 58313858 missense probably benign 0.00
IGL02259:Cntnap5c APN 17 58034862 missense probably damaging 0.98
IGL02270:Cntnap5c APN 17 58034853 missense probably benign 0.08
IGL02312:Cntnap5c APN 17 58138699 missense probably benign 0.09
IGL02456:Cntnap5c APN 17 58407744 splice site probably benign
IGL02755:Cntnap5c APN 17 58364194 missense probably benign 0.02
IGL02955:Cntnap5c APN 17 57892102 splice site probably benign
IGL03001:Cntnap5c APN 17 58055639 missense probably damaging 1.00
IGL03012:Cntnap5c APN 17 58359234 missense probably benign 0.01
IGL03243:Cntnap5c APN 17 58102176 missense probably benign 0.01
IGL03375:Cntnap5c APN 17 58162205 missense possibly damaging 0.94
IGL02802:Cntnap5c UTSW 17 58305684 missense probably benign 0.04
LCD18:Cntnap5c UTSW 17 58162160 intron probably benign
R0003:Cntnap5c UTSW 17 58199017 missense probably benign
R0041:Cntnap5c UTSW 17 57876469 missense probably benign 0.00
R0041:Cntnap5c UTSW 17 57876469 missense probably benign 0.00
R0046:Cntnap5c UTSW 17 58359300 missense probably benign
R0046:Cntnap5c UTSW 17 58359300 missense probably benign
R0179:Cntnap5c UTSW 17 57769625 missense probably benign 0.19
R0244:Cntnap5c UTSW 17 58102168 missense probably damaging 1.00
R0445:Cntnap5c UTSW 17 58104743 missense probably benign 0.01
R0626:Cntnap5c UTSW 17 58042427 missense probably benign 0.29
R0675:Cntnap5c UTSW 17 58034995 missense probably damaging 1.00
R0681:Cntnap5c UTSW 17 58305555 missense possibly damaging 0.91
R0699:Cntnap5c UTSW 17 58042498 missense probably damaging 1.00
R0927:Cntnap5c UTSW 17 58042558 missense possibly damaging 0.78
R1081:Cntnap5c UTSW 17 58305525 missense possibly damaging 0.90
R1132:Cntnap5c UTSW 17 58294356 missense probably damaging 1.00
R1175:Cntnap5c UTSW 17 58364246 missense possibly damaging 0.51
R1640:Cntnap5c UTSW 17 58395294 missense probably benign 0.01
R1664:Cntnap5c UTSW 17 58293990 missense probably benign 0.00
R1758:Cntnap5c UTSW 17 58042550 missense probably damaging 1.00
R1785:Cntnap5c UTSW 17 58162291 missense probably benign 0.00
R1789:Cntnap5c UTSW 17 58013921 missense probably damaging 1.00
R1968:Cntnap5c UTSW 17 58359296 missense probably damaging 1.00
R2041:Cntnap5c UTSW 17 58104770 critical splice donor site probably null
R2041:Cntnap5c UTSW 17 58198989 missense probably benign 0.02
R2073:Cntnap5c UTSW 17 58305552 missense possibly damaging 0.58
R2093:Cntnap5c UTSW 17 58199000 missense probably benign 0.00
R2134:Cntnap5c UTSW 17 58407722 missense probably damaging 1.00
R2153:Cntnap5c UTSW 17 58055671 missense possibly damaging 0.90
R2176:Cntnap5c UTSW 17 58013946 missense probably benign 0.04
R2256:Cntnap5c UTSW 17 58330315 missense probably benign 0.00
R2847:Cntnap5c UTSW 17 57876392 missense probably damaging 0.99
R2848:Cntnap5c UTSW 17 57876392 missense probably damaging 0.99
R2850:Cntnap5c UTSW 17 58410348 utr 3 prime probably benign
R3008:Cntnap5c UTSW 17 58359209 missense probably damaging 1.00
R3714:Cntnap5c UTSW 17 57892067 nonsense probably null
R3720:Cntnap5c UTSW 17 58330202 missense probably benign
R3755:Cntnap5c UTSW 17 58104599 missense possibly damaging 0.82
R4001:Cntnap5c UTSW 17 58407740 critical splice donor site probably null
R4619:Cntnap5c UTSW 17 58410268 missense probably benign
R5146:Cntnap5c UTSW 17 58013847 missense probably damaging 0.96
R5309:Cntnap5c UTSW 17 58359254 missense probably benign 0.05
R5312:Cntnap5c UTSW 17 58359254 missense probably benign 0.05
R5722:Cntnap5c UTSW 17 58313857 missense probably benign 0.01
R5974:Cntnap5c UTSW 17 57876485 missense probably benign 0.00
R6017:Cntnap5c UTSW 17 58104698 missense probably benign 0.41
R6059:Cntnap5c UTSW 17 58313712 missense probably damaging 0.99
R6152:Cntnap5c UTSW 17 58286886 missense possibly damaging 0.65
R6182:Cntnap5c UTSW 17 57876395 missense probably benign 0.00
R6298:Cntnap5c UTSW 17 58104752 missense probably damaging 1.00
R6301:Cntnap5c UTSW 17 57892037 missense probably benign 0.01
R6514:Cntnap5c UTSW 17 58330170 missense probably damaging 0.96
R6583:Cntnap5c UTSW 17 58330277 missense probably damaging 1.00
R6688:Cntnap5c UTSW 17 58293904 missense possibly damaging 0.71
R6781:Cntnap5c UTSW 17 58138653 nonsense probably null
R6866:Cntnap5c UTSW 17 58092294 missense probably benign
R6906:Cntnap5c UTSW 17 58395307 missense probably benign 0.18
R6911:Cntnap5c UTSW 17 57892014 missense probably damaging 1.00
R6919:Cntnap5c UTSW 17 58293953 missense probably benign 0.02
R6923:Cntnap5c UTSW 17 58092350 missense possibly damaging 0.96
R6925:Cntnap5c UTSW 17 58395266 missense probably benign 0.39
R6982:Cntnap5c UTSW 17 58092252 missense possibly damaging 0.77
R7144:Cntnap5c UTSW 17 58286888 missense probably benign
R7422:Cntnap5c UTSW 17 58410231 nonsense probably null
R7797:Cntnap5c UTSW 17 58359275 missense probably benign 0.11
R7830:Cntnap5c UTSW 17 58162250 missense probably damaging 1.00
R8169:Cntnap5c UTSW 17 58104770 critical splice donor site probably null
R8351:Cntnap5c UTSW 17 58055692 missense probably damaging 1.00
R8352:Cntnap5c UTSW 17 58055692 missense probably damaging 1.00
R8451:Cntnap5c UTSW 17 58055692 missense probably damaging 1.00
R8452:Cntnap5c UTSW 17 58055692 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACCAATCTGTAACTATGCCC -3'
(R):5'- AATCCCTATTGAATTTGGTGTGTGC -3'

Sequencing Primer
(F):5'- ACATTTTACATGTACACCTGCATG -3'
(R):5'- TGTGTGCTTATTTCTCTCTTAGTAAC -3'
Posted On2019-12-04