Incidental Mutation 'RF010:Prkce'
ID603170
Institutional Source Beutler Lab
Gene Symbol Prkce
Ensembl Gene ENSMUSG00000045038
Gene Nameprotein kinase C, epsilon
SynonymsPkce, PKCepsilon, PKC[e], 5830406C15Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF010 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location86167785-86657919 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86488199 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 288 (V288A)
Ref Sequence ENSEMBL: ENSMUSP00000094873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097274] [ENSMUST00000097275]
Predicted Effect probably damaging
Transcript: ENSMUST00000097274
AA Change: V288A

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000094873
Gene: ENSMUSG00000045038
AA Change: V288A

DomainStartEndE-ValueType
C2 7 114 5.78e-12 SMART
C1 170 220 4.48e-13 SMART
C1 243 292 8.29e-17 SMART
S_TKc 408 668 1.3e-104 SMART
S_TK_X 669 732 2.56e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097275
AA Change: V288A

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000094874
Gene: ENSMUSG00000045038
AA Change: V288A

DomainStartEndE-ValueType
C2 7 114 5.78e-12 SMART
C1 170 220 4.48e-13 SMART
C1 243 292 8.29e-17 SMART
S_TKc 408 668 1.3e-104 SMART
S_TK_X 669 732 2.56e-25 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been shown to be involved in many different cellular functions, such as neuron channel activation, apoptosis, cardioprotection from ischemia, heat shock response, as well as insulin exocytosis. Knockout studies in mice suggest that this kinase is important for lipopolysaccharide (LPS)-mediated signaling in activated macrophages and may also play a role in controlling anxiety-like behavior. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced ethanol self-administration and are more sensitive to the acute behavioral effects of ethanol and other drugs that activate GABA(A) receptors. Mutants show reduced anxiety and stress hormones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik GGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG GGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG 17: 35,568,576 probably benign Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,905,096 probably benign Het
Ankrd28 A G 14: 31,778,986 I16T probably damaging Het
AY761185 GCACTGTGGGC G 8: 20,943,911 probably null Het
B020031M17Rik A T 13: 119,950,046 V8E probably benign Het
Bend3 T A 10: 43,510,184 F191Y possibly damaging Het
Calhm1 GTGGC GTGGCTGTGGCTATGGC 19: 47,141,273 probably benign Het
Camkv CGCTGCTGC CGC 9: 107,947,860 probably benign Het
Chga GCA GCATCA 12: 102,561,403 probably benign Het
Cngb1 CTCTGGCTCTGGCTCTGGCTCTG C 8: 95,303,650 probably null Het
Cnot3 T C 7: 3,656,069 V438A probably benign Het
Cntnap5c T A 17: 58,286,795 W710R probably damaging Het
Dyrk1a A G 16: 94,677,563 S404G probably benign Het
Efhd2 GCCGCC GCCGCCTCCGCC 4: 141,874,764 probably benign Het
Flywch1 GTGT GTGTGGGGAGGCTACGTACTCACCCACACCTGTTGT 17: 23,762,175 probably null Het
Fmn2 T A 1: 174,582,015 S605T unknown Het
Gab3 TCT TCTGCT X: 75,000,011 probably benign Het
Gabre GCTC GCTCCGTCTC X: 72,270,060 probably benign Het
Gli3 A G 13: 15,726,369 Y1447C probably damaging Het
Hibch T C 1: 52,913,732 V297A probably benign Het
Ifi213 C G 1: 173,582,153 D462H probably damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Lce1m GCTGCTGCC GCTGCTGCCCCCACTGCTGCC 3: 93,018,290 probably benign Het
Lpo A G 11: 87,821,102 V43A probably benign Het
Map1a A AGCTCCAGCTCCAGCCCCACCTCCAGCTCCC 2: 121,306,318 probably benign Het
Mapk9 A G 11: 49,854,256 probably benign Het
Mep1a G A 17: 43,486,235 H314Y probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myh3 AC ACTTCC 11: 67,086,359 probably null Het
Nusap1 ACGTTAGCAGTGAGGAGCAA ACGTTAGCAGTGAGGAGCAAACTGAGATACTCGTTAGCAGTGAGGAGCAA 2: 119,627,584 probably benign Het
Olfr1118 T A 2: 87,308,840 V37E possibly damaging Het
Olfr305 T C 7: 86,363,386 Q317R probably benign Het
Pdcd11 AGGAGG A 19: 47,113,451 probably null Het
Pfkm T A 15: 98,129,793 I651N possibly damaging Het
Phldb3 CCCCCGCCCC CCCCC 7: 24,626,495 probably null Het
Pxmp4 A G 2: 154,592,263 S93P probably damaging Het
Rfc4 T C 16: 23,127,482 T17A probably benign Het
Rfx4 CTCTCTCT CTCTCTCTCTCTCTCTATCTCTCT 10: 84,858,487 probably benign Het
Ryr3 G T 2: 112,775,670 A2415E probably damaging Het
Sbp ACAAAGATGCTGACAACAAAGATGCTGACA ACAAAGATGCTGACACCAAAGATGCTGACAACAAAGATGCTGACA 17: 23,945,351 probably benign Het
Sec24c T A 14: 20,688,715 probably null Het
Sec63 C A 10: 42,806,624 A437E probably benign Het
Six3 GCG GCGTCG 17: 85,621,355 probably benign Het
Slco5a1 G A 1: 12,871,947 T825I probably damaging Het
Stard8 GGA GGAAGA X: 99,066,517 probably benign Het
Stxbp1 A G 2: 32,821,915 V30A probably benign Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,727,662 probably benign Het
Syne1 T A 10: 5,246,386 D3882V possibly damaging Het
T A G 17: 8,441,708 T384A probably benign Het
Tbc1d12 CGGGGCGG CG 19: 38,836,940 probably benign Het
Tcof1 CAG CAGAAG 18: 60,835,744 probably benign Het
Tfeb GCA GCAACA 17: 47,786,094 probably benign Het
Tfeb CAG CAGAAG 17: 47,786,107 probably benign Het
Thegl CAG CAGCGATCCTCCCCAGTCCCGCAAGGCGAG 5: 77,016,427 probably benign Het
Thumpd3 C T 6: 113,056,045 A248V probably damaging Het
Tmem181a T C 17: 6,280,703 probably null Het
Tmem56 T A 3: 121,228,884 I103L probably benign Het
Trim41 A T 11: 48,807,338 H600Q probably damaging Het
Ttbk2 A T 2: 120,790,339 C147* probably null Het
Ttll2 C T 17: 7,351,338 A397T probably benign Het
Unc79 T A 12: 103,112,787 L1737Q probably benign Het
Usp47 T A 7: 112,092,938 V869E probably damaging Het
Vmn1r231 T A 17: 20,889,993 Q220L probably damaging Het
Vmn2r26 C T 6: 124,039,489 T304I possibly damaging Het
Wdr66 TCTCA T 5: 123,274,161 probably benign Het
Wrn T C 8: 33,288,765 N839S probably benign Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,036,471 probably benign Het
Zfp384 GGCCCAGG GGCCCAGGAGCACGCCCAGG 6: 125,036,488 probably benign Het
Zfyve26 C T 12: 79,255,338 C1828Y probably damaging Het
Znrd1as CACCACCAC CACCACCACCACCACCACCACTACCACCAC 17: 36,965,063 probably benign Het
Other mutations in Prkce
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Prkce APN 17 86625462 missense probably damaging 0.99
IGL01401:Prkce APN 17 86168840 missense probably damaging 1.00
IGL01508:Prkce APN 17 86630085 missense probably damaging 1.00
IGL02500:Prkce APN 17 86168914 missense probably benign 0.16
IGL02957:Prkce APN 17 86496026 missense possibly damaging 0.74
IGL03114:Prkce APN 17 86654555 missense probably damaging 0.97
Pinnacles UTSW 17 86476851 missense probably damaging 1.00
R0063:Prkce UTSW 17 86482111 splice site probably benign
R0063:Prkce UTSW 17 86482111 splice site probably benign
R0403:Prkce UTSW 17 86168653 missense probably damaging 0.98
R0900:Prkce UTSW 17 86625458 missense probably damaging 1.00
R0919:Prkce UTSW 17 86630160 missense probably benign 0.06
R1413:Prkce UTSW 17 86496018 missense possibly damaging 0.81
R1430:Prkce UTSW 17 86559137 splice site probably benign
R1843:Prkce UTSW 17 86475546 nonsense probably null
R2129:Prkce UTSW 17 86496035 missense possibly damaging 0.89
R2341:Prkce UTSW 17 86474442 missense probably damaging 1.00
R2511:Prkce UTSW 17 86625326 missense probably damaging 1.00
R2679:Prkce UTSW 17 86176226 intron probably benign
R3724:Prkce UTSW 17 86168623 nonsense probably null
R3853:Prkce UTSW 17 86168849 missense probably damaging 1.00
R4364:Prkce UTSW 17 86476851 missense probably damaging 1.00
R4467:Prkce UTSW 17 86619911 missense possibly damaging 0.68
R4523:Prkce UTSW 17 86490750 critical splice acceptor site probably null
R4838:Prkce UTSW 17 86630083 missense probably benign 0.07
R5140:Prkce UTSW 17 86482142 missense probably benign 0.12
R5579:Prkce UTSW 17 86619948 missense probably damaging 1.00
R6026:Prkce UTSW 17 86493230 missense probably benign 0.02
R6048:Prkce UTSW 17 86493347 missense probably benign
R6212:Prkce UTSW 17 86559301 missense probably damaging 1.00
R6484:Prkce UTSW 17 86490809 missense probably benign
R6788:Prkce UTSW 17 86630061 missense probably damaging 1.00
R6915:Prkce UTSW 17 86493407 missense probably damaging 1.00
R7349:Prkce UTSW 17 86493355 missense probably benign
R7447:Prkce UTSW 17 86559259 missense probably damaging 1.00
R7566:Prkce UTSW 17 86493329 missense probably benign 0.00
R7577:Prkce UTSW 17 86493293 nonsense probably null
R7638:Prkce UTSW 17 86168600 missense probably benign 0.26
R8237:Prkce UTSW 17 86559218 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATGACAGTAGTTCTCTCTAATGGG -3'
(R):5'- AAGGTGCCGATCCTAAACCC -3'

Sequencing Primer
(F):5'- CAGTAGTTCTCTCTAATGGGATAGGC -3'
(R):5'- TCCTAAACCCAGGAATCCCC -3'
Posted On2019-12-04