Incidental Mutation 'RF010:Prkce'
ID 603170
Institutional Source Beutler Lab
Gene Symbol Prkce
Ensembl Gene ENSMUSG00000045038
Gene Name protein kinase C, epsilon
Synonyms PKCepsilon, PCK epsilon, Pkce, PKC[e], 5830406C15Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # RF010 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 86475213-86965347 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86795627 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 288 (V288A)
Ref Sequence ENSEMBL: ENSMUSP00000094873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097274] [ENSMUST00000097275]
AlphaFold P16054
Predicted Effect probably damaging
Transcript: ENSMUST00000097274
AA Change: V288A

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000094873
Gene: ENSMUSG00000045038
AA Change: V288A

DomainStartEndE-ValueType
C2 7 114 5.78e-12 SMART
C1 170 220 4.48e-13 SMART
C1 243 292 8.29e-17 SMART
S_TKc 408 668 1.3e-104 SMART
S_TK_X 669 732 2.56e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097275
AA Change: V288A

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000094874
Gene: ENSMUSG00000045038
AA Change: V288A

DomainStartEndE-ValueType
C2 7 114 5.78e-12 SMART
C1 170 220 4.48e-13 SMART
C1 243 292 8.29e-17 SMART
S_TKc 408 668 1.3e-104 SMART
S_TK_X 669 732 2.56e-25 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been shown to be involved in many different cellular functions, such as neuron channel activation, apoptosis, cardioprotection from ischemia, heat shock response, as well as insulin exocytosis. Knockout studies in mice suggest that this kinase is important for lipopolysaccharide (LPS)-mediated signaling in activated macrophages and may also play a role in controlling anxiety-like behavior. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced ethanol self-administration and are more sensitive to the acute behavioral effects of ethanol and other drugs that activate GABA(A) receptors. Mutants show reduced anxiety and stress hormones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik GGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG GGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG 17: 35,879,473 (GRCm39) probably benign Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,989,553 (GRCm39) probably benign Het
Ankrd28 A G 14: 31,500,943 (GRCm39) I16T probably damaging Het
AY761185 GCACTGTGGGC G 8: 21,433,927 (GRCm39) probably null Het
Bend3 T A 10: 43,386,180 (GRCm39) F191Y possibly damaging Het
Calhm1 GTGGC GTGGCTGTGGCTATGGC 19: 47,129,712 (GRCm39) probably benign Het
Camkv CGCTGCTGC CGC 9: 107,825,059 (GRCm39) probably benign Het
Cfap251 TCTCA T 5: 123,412,224 (GRCm39) probably benign Het
Chga GCA GCATCA 12: 102,527,662 (GRCm39) probably benign Het
Cngb1 CTCTGGCTCTGGCTCTGGCTCTG C 8: 96,030,278 (GRCm39) probably null Het
Cnot3 T C 7: 3,659,068 (GRCm39) V438A probably benign Het
Cntnap5c T A 17: 58,593,790 (GRCm39) W710R probably damaging Het
Dyrk1a A G 16: 94,478,422 (GRCm39) S404G probably benign Het
Efhd2 GCCGCC GCCGCCTCCGCC 4: 141,602,075 (GRCm39) probably benign Het
Flywch1 GTGT GTGTGGGGAGGCTACGTACTCACCCACACCTGTTGT 17: 23,981,149 (GRCm39) probably null Het
Fmn2 T A 1: 174,409,581 (GRCm39) S605T unknown Het
Gab3 TCT TCTGCT X: 74,043,617 (GRCm39) probably benign Het
Gabre GCTC GCTCCGTCTC X: 71,313,666 (GRCm39) probably benign Het
Gli3 A G 13: 15,900,954 (GRCm39) Y1447C probably damaging Het
Hibch T C 1: 52,952,891 (GRCm39) V297A probably benign Het
Ifi213 C G 1: 173,409,719 (GRCm39) D462H probably damaging Het
Kcnh8 G A 17: 53,285,267 (GRCm39) R1079H probably benign Het
Lce1m GCTGCTGCC GCTGCTGCCCCCACTGCTGCC 3: 92,925,597 (GRCm39) probably benign Het
Lpo A G 11: 87,711,928 (GRCm39) V43A probably benign Het
Map1a A AGCTCCAGCTCCAGCCCCACCTCCAGCTCCC 2: 121,136,799 (GRCm39) probably benign Het
Mapk9 A G 11: 49,745,083 (GRCm39) probably benign Het
Mep1a G A 17: 43,797,126 (GRCm39) H314Y probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 66,977,182 (GRCm39) probably null Het
Myh3 AC ACTTCC 11: 66,977,185 (GRCm39) probably null Het
Nusap1 ACGTTAGCAGTGAGGAGCAA ACGTTAGCAGTGAGGAGCAAACTGAGATACTCGTTAGCAGTGAGGAGCAA 2: 119,458,065 (GRCm39) probably benign Het
Or10ag56 T A 2: 87,139,184 (GRCm39) V37E possibly damaging Het
Or14a259 T C 7: 86,012,594 (GRCm39) Q317R probably benign Het
Pdcd11 AGGAGG A 19: 47,101,890 (GRCm39) probably null Het
Pfkm T A 15: 98,027,674 (GRCm39) I651N possibly damaging Het
Phldb3 CCCCCGCCCC CCCCC 7: 24,325,920 (GRCm39) probably null Het
Polr1has CACCACCAC CACCACCACCACCACCACCACTACCACCAC 17: 37,275,955 (GRCm39) probably benign Het
Pxmp4 A G 2: 154,434,183 (GRCm39) S93P probably damaging Het
Rfc4 T C 16: 22,946,232 (GRCm39) T17A probably benign Het
Rfx4 CTCTCTCT CTCTCTCTCTCTCTCTATCTCTCT 10: 84,694,351 (GRCm39) probably benign Het
Ryr3 G T 2: 112,606,015 (GRCm39) A2415E probably damaging Het
Sbp ACAAAGATGCTGACAACAAAGATGCTGACA ACAAAGATGCTGACACCAAAGATGCTGACAACAAAGATGCTGACA 17: 24,164,325 (GRCm39) probably benign Het
Sec24c T A 14: 20,738,783 (GRCm39) probably null Het
Sec63 C A 10: 42,682,620 (GRCm39) A437E probably benign Het
Six3 GCG GCGTCG 17: 85,928,783 (GRCm39) probably benign Het
Slco5a1 G A 1: 12,942,171 (GRCm39) T825I probably damaging Het
Spmap2l CAG CAGCGATCCTCCCCAGTCCCGCAAGGCGAG 5: 77,164,274 (GRCm39) probably benign Het
Stard8 GGA GGAAGA X: 98,110,123 (GRCm39) probably benign Het
Stxbp1 A G 2: 32,711,927 (GRCm39) V30A probably benign Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,635,083 (GRCm39) probably benign Het
Syne1 T A 10: 5,196,386 (GRCm39) D3882V possibly damaging Het
T A G 17: 8,660,540 (GRCm39) T384A probably benign Het
Tbc1d12 CGGGGCGG CG 19: 38,825,384 (GRCm39) probably benign Het
Tcof1 CAG CAGAAG 18: 60,968,816 (GRCm39) probably benign Het
Tcstv5 A T 13: 120,411,582 (GRCm39) V8E probably benign Het
Tfeb GCA GCAACA 17: 48,097,019 (GRCm39) probably benign Het
Tfeb CAG CAGAAG 17: 48,097,032 (GRCm39) probably benign Het
Thumpd3 C T 6: 113,033,006 (GRCm39) A248V probably damaging Het
Tlcd4 T A 3: 121,022,533 (GRCm39) I103L probably benign Het
Tmem181a T C 17: 6,330,978 (GRCm39) probably null Het
Trim41 A T 11: 48,698,165 (GRCm39) H600Q probably damaging Het
Ttbk2 A T 2: 120,620,820 (GRCm39) C147* probably null Het
Ttll2 C T 17: 7,618,737 (GRCm39) A397T probably benign Het
Unc79 T A 12: 103,079,046 (GRCm39) L1737Q probably benign Het
Usp47 T A 7: 111,692,145 (GRCm39) V869E probably damaging Het
Vmn1r231 T A 17: 21,110,255 (GRCm39) Q220L probably damaging Het
Vmn2r26 C T 6: 124,016,448 (GRCm39) T304I possibly damaging Het
Wrn T C 8: 33,778,793 (GRCm39) N839S probably benign Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,013,434 (GRCm39) probably benign Het
Zfp384 GGCCCAGG GGCCCAGGAGCACGCCCAGG 6: 125,013,451 (GRCm39) probably benign Het
Zfyve26 C T 12: 79,302,112 (GRCm39) C1828Y probably damaging Het
Other mutations in Prkce
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Prkce APN 17 86,932,890 (GRCm39) missense probably damaging 0.99
IGL01401:Prkce APN 17 86,476,268 (GRCm39) missense probably damaging 1.00
IGL01508:Prkce APN 17 86,937,513 (GRCm39) missense probably damaging 1.00
IGL02500:Prkce APN 17 86,476,342 (GRCm39) missense probably benign 0.16
IGL02957:Prkce APN 17 86,803,454 (GRCm39) missense possibly damaging 0.74
IGL03114:Prkce APN 17 86,961,983 (GRCm39) missense probably damaging 0.97
Pinnacles UTSW 17 86,784,279 (GRCm39) missense probably damaging 1.00
R0063:Prkce UTSW 17 86,789,539 (GRCm39) splice site probably benign
R0063:Prkce UTSW 17 86,789,539 (GRCm39) splice site probably benign
R0403:Prkce UTSW 17 86,476,081 (GRCm39) missense probably damaging 0.98
R0900:Prkce UTSW 17 86,932,886 (GRCm39) missense probably damaging 1.00
R0919:Prkce UTSW 17 86,937,588 (GRCm39) missense probably benign 0.06
R1413:Prkce UTSW 17 86,803,446 (GRCm39) missense possibly damaging 0.81
R1430:Prkce UTSW 17 86,866,565 (GRCm39) splice site probably benign
R1843:Prkce UTSW 17 86,782,974 (GRCm39) nonsense probably null
R2129:Prkce UTSW 17 86,803,463 (GRCm39) missense possibly damaging 0.89
R2341:Prkce UTSW 17 86,781,870 (GRCm39) missense probably damaging 1.00
R2511:Prkce UTSW 17 86,932,754 (GRCm39) missense probably damaging 1.00
R2679:Prkce UTSW 17 86,483,654 (GRCm39) intron probably benign
R3724:Prkce UTSW 17 86,476,051 (GRCm39) nonsense probably null
R3853:Prkce UTSW 17 86,476,277 (GRCm39) missense probably damaging 1.00
R4364:Prkce UTSW 17 86,784,279 (GRCm39) missense probably damaging 1.00
R4467:Prkce UTSW 17 86,927,339 (GRCm39) missense possibly damaging 0.68
R4523:Prkce UTSW 17 86,798,178 (GRCm39) critical splice acceptor site probably null
R4838:Prkce UTSW 17 86,937,511 (GRCm39) missense probably benign 0.07
R5140:Prkce UTSW 17 86,789,570 (GRCm39) missense probably benign 0.12
R5579:Prkce UTSW 17 86,927,376 (GRCm39) missense probably damaging 1.00
R6026:Prkce UTSW 17 86,800,658 (GRCm39) missense probably benign 0.02
R6048:Prkce UTSW 17 86,800,775 (GRCm39) missense probably benign
R6212:Prkce UTSW 17 86,866,729 (GRCm39) missense probably damaging 1.00
R6484:Prkce UTSW 17 86,798,237 (GRCm39) missense probably benign
R6788:Prkce UTSW 17 86,937,489 (GRCm39) missense probably damaging 1.00
R6915:Prkce UTSW 17 86,800,835 (GRCm39) missense probably damaging 1.00
R7349:Prkce UTSW 17 86,800,783 (GRCm39) missense probably benign
R7447:Prkce UTSW 17 86,866,687 (GRCm39) missense probably damaging 1.00
R7566:Prkce UTSW 17 86,800,757 (GRCm39) missense probably benign 0.00
R7577:Prkce UTSW 17 86,800,721 (GRCm39) nonsense probably null
R7638:Prkce UTSW 17 86,476,028 (GRCm39) missense probably benign 0.26
R8237:Prkce UTSW 17 86,866,646 (GRCm39) missense probably damaging 1.00
R8711:Prkce UTSW 17 86,795,625 (GRCm39) missense probably damaging 1.00
R8869:Prkce UTSW 17 86,476,370 (GRCm39) critical splice donor site probably null
R9342:Prkce UTSW 17 86,781,877 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATGACAGTAGTTCTCTCTAATGGG -3'
(R):5'- AAGGTGCCGATCCTAAACCC -3'

Sequencing Primer
(F):5'- CAGTAGTTCTCTCTAATGGGATAGGC -3'
(R):5'- TCCTAAACCCAGGAATCCCC -3'
Posted On 2019-12-04