Incidental Mutation 'RF010:Calhm1'
ID603174
Institutional Source Beutler Lab
Gene Symbol Calhm1
Ensembl Gene ENSMUSG00000079258
Gene Namecalcium homeostasis modulator 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF010 (G1)
Quality Score217.68
Status Not validated
Chromosome19
Chromosomal Location47141035-47144174 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) GTGGC to GTGGCTGTGGCTATGGC at 47141273 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035822] [ENSMUST00000111813] [ENSMUST00000140512]
Predicted Effect probably benign
Transcript: ENSMUST00000035822
SMART Domains Protein: ENSMUSP00000047278
Gene: ENSMUSG00000033033

DomainStartEndE-ValueType
Pfam:Ca_hom_mod 6 256 2.3e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111813
SMART Domains Protein: ENSMUSP00000107444
Gene: ENSMUSG00000079258

DomainStartEndE-ValueType
Pfam:Ca_hom_mod 1 255 5.6e-94 PFAM
low complexity region 267 276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140512
SMART Domains Protein: ENSMUSP00000121661
Gene: ENSMUSG00000033033

DomainStartEndE-ValueType
Pfam:Ca_hom_mod 6 258 2.9e-93 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a calcium channel that plays a role in processing of amyloid-beta precursor protein. A polymorphism at this locus has been reported to be associated with susceptibility to late-onset Alzheimer's disease in some populations, but the pathogenicity of this polymorphism is unclear.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered cortical neuron electrical properties. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik GGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG GGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG 17: 35,568,576 probably benign Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,905,096 probably benign Het
Ankrd28 A G 14: 31,778,986 I16T probably damaging Het
AY761185 GCACTGTGGGC G 8: 20,943,911 probably null Het
B020031M17Rik A T 13: 119,950,046 V8E probably benign Het
Bend3 T A 10: 43,510,184 F191Y possibly damaging Het
Camkv CGCTGCTGC CGC 9: 107,947,860 probably benign Het
Chga GCA GCATCA 12: 102,561,403 probably benign Het
Cngb1 CTCTGGCTCTGGCTCTGGCTCTG C 8: 95,303,650 probably null Het
Cnot3 T C 7: 3,656,069 V438A probably benign Het
Cntnap5c T A 17: 58,286,795 W710R probably damaging Het
Dyrk1a A G 16: 94,677,563 S404G probably benign Het
Efhd2 GCCGCC GCCGCCTCCGCC 4: 141,874,764 probably benign Het
Flywch1 GTGT GTGTGGGGAGGCTACGTACTCACCCACACCTGTTGT 17: 23,762,175 probably null Het
Fmn2 T A 1: 174,582,015 S605T unknown Het
Gab3 TCT TCTGCT X: 75,000,011 probably benign Het
Gabre GCTC GCTCCGTCTC X: 72,270,060 probably benign Het
Gli3 A G 13: 15,726,369 Y1447C probably damaging Het
Hibch T C 1: 52,913,732 V297A probably benign Het
Ifi213 C G 1: 173,582,153 D462H probably damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Lce1m GCTGCTGCC GCTGCTGCCCCCACTGCTGCC 3: 93,018,290 probably benign Het
Lpo A G 11: 87,821,102 V43A probably benign Het
Map1a A AGCTCCAGCTCCAGCCCCACCTCCAGCTCCC 2: 121,306,318 probably benign Het
Mapk9 A G 11: 49,854,256 probably benign Het
Mep1a G A 17: 43,486,235 H314Y probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myh3 AC ACTTCC 11: 67,086,359 probably null Het
Nusap1 ACGTTAGCAGTGAGGAGCAA ACGTTAGCAGTGAGGAGCAAACTGAGATACTCGTTAGCAGTGAGGAGCAA 2: 119,627,584 probably benign Het
Olfr1118 T A 2: 87,308,840 V37E possibly damaging Het
Olfr305 T C 7: 86,363,386 Q317R probably benign Het
Pdcd11 AGGAGG A 19: 47,113,451 probably null Het
Pfkm T A 15: 98,129,793 I651N possibly damaging Het
Phldb3 CCCCCGCCCC CCCCC 7: 24,626,495 probably null Het
Prkce T C 17: 86,488,199 V288A probably damaging Het
Pxmp4 A G 2: 154,592,263 S93P probably damaging Het
Rfc4 T C 16: 23,127,482 T17A probably benign Het
Rfx4 CTCTCTCT CTCTCTCTCTCTCTCTATCTCTCT 10: 84,858,487 probably benign Het
Ryr3 G T 2: 112,775,670 A2415E probably damaging Het
Sbp ACAAAGATGCTGACAACAAAGATGCTGACA ACAAAGATGCTGACACCAAAGATGCTGACAACAAAGATGCTGACA 17: 23,945,351 probably benign Het
Sec24c T A 14: 20,688,715 probably null Het
Sec63 C A 10: 42,806,624 A437E probably benign Het
Six3 GCG GCGTCG 17: 85,621,355 probably benign Het
Slco5a1 G A 1: 12,871,947 T825I probably damaging Het
Stard8 GGA GGAAGA X: 99,066,517 probably benign Het
Stxbp1 A G 2: 32,821,915 V30A probably benign Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,727,662 probably benign Het
Syne1 T A 10: 5,246,386 D3882V possibly damaging Het
T A G 17: 8,441,708 T384A probably benign Het
Tbc1d12 CGGGGCGG CG 19: 38,836,940 probably benign Het
Tcof1 CAG CAGAAG 18: 60,835,744 probably benign Het
Tfeb GCA GCAACA 17: 47,786,094 probably benign Het
Tfeb CAG CAGAAG 17: 47,786,107 probably benign Het
Thegl CAG CAGCGATCCTCCCCAGTCCCGCAAGGCGAG 5: 77,016,427 probably benign Het
Thumpd3 C T 6: 113,056,045 A248V probably damaging Het
Tmem181a T C 17: 6,280,703 probably null Het
Tmem56 T A 3: 121,228,884 I103L probably benign Het
Trim41 A T 11: 48,807,338 H600Q probably damaging Het
Ttbk2 A T 2: 120,790,339 C147* probably null Het
Ttll2 C T 17: 7,351,338 A397T probably benign Het
Unc79 T A 12: 103,112,787 L1737Q probably benign Het
Usp47 T A 7: 112,092,938 V869E probably damaging Het
Vmn1r231 T A 17: 20,889,993 Q220L probably damaging Het
Vmn2r26 C T 6: 124,039,489 T304I possibly damaging Het
Wdr66 TCTCA T 5: 123,274,161 probably benign Het
Wrn T C 8: 33,288,765 N839S probably benign Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,036,471 probably benign Het
Zfp384 GGCCCAGG GGCCCAGGAGCACGCCCAGG 6: 125,036,488 probably benign Het
Zfyve26 C T 12: 79,255,338 C1828Y probably damaging Het
Znrd1as CACCACCAC CACCACCACCACCACCACCACTACCACCAC 17: 36,965,063 probably benign Het
Other mutations in Calhm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4340:Calhm1 UTSW 19 47141251 unclassified probably benign
FR4449:Calhm1 UTSW 19 47141274 unclassified probably benign
FR4976:Calhm1 UTSW 19 47141262 unclassified probably benign
R0328:Calhm1 UTSW 19 47141303 missense possibly damaging 0.46
R0402:Calhm1 UTSW 19 47141457 missense probably damaging 0.98
R0463:Calhm1 UTSW 19 47143841 missense probably benign 0.16
R0608:Calhm1 UTSW 19 47143841 missense probably benign 0.16
R1552:Calhm1 UTSW 19 47141201 missense probably benign 0.00
R4647:Calhm1 UTSW 19 47143801 missense probably damaging 0.98
R4648:Calhm1 UTSW 19 47143801 missense probably damaging 0.98
R5762:Calhm1 UTSW 19 47143619 splice site probably null
R5766:Calhm1 UTSW 19 47143703 missense probably benign 0.00
RF001:Calhm1 UTSW 19 47141276 unclassified probably benign
RF014:Calhm1 UTSW 19 47141265 unclassified probably benign
RF015:Calhm1 UTSW 19 47141256 unclassified probably benign
RF023:Calhm1 UTSW 19 47141273 unclassified probably benign
RF025:Calhm1 UTSW 19 47141276 unclassified probably benign
RF025:Calhm1 UTSW 19 47141277 unclassified probably benign
RF030:Calhm1 UTSW 19 47141253 unclassified probably benign
RF032:Calhm1 UTSW 19 47141283 frame shift probably null
RF035:Calhm1 UTSW 19 47141253 unclassified probably benign
RF036:Calhm1 UTSW 19 47141277 unclassified probably benign
RF040:Calhm1 UTSW 19 47141277 unclassified probably benign
RF050:Calhm1 UTSW 19 47141270 unclassified probably benign
RF057:Calhm1 UTSW 19 47141270 unclassified probably benign
RF063:Calhm1 UTSW 19 47141256 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AAGTAGGTGGCCACTTCCTTG -3'
(R):5'- GCCTTTCTCAAGAGCAAGTACTG -3'

Sequencing Primer
(F):5'- ACTTCCTTGCGTGGAGGC -3'
(R):5'- GGTCCCACTACATTGACATTGAG -3'
Posted On2019-12-04