Incidental Mutation 'RF011:A030005L19Rik'
Institutional Source Beutler Lab
Gene Symbol A030005L19Rik
Ensembl Gene ENSMUSG00000113880
Gene NameRIKEN cDNA A030005L19 gene
Accession Numbers
Is this an essential gene? Not available question?
Stock #RF011 (G1)
Quality Score217.68
Status Not validated
Chromosomal Location82913325-82914130 bp(+) (GRCm38)
Type of Mutationsmall insertion (3 aa in frame mutation)
DNA Base Change (assembly) TGGCTGCTG to TGGCTGCTGGGGCTGCTG at 82913573 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152156 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000220768
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,743,609 K672R possibly damaging Het
AI837181 GCG GCGTCG 19: 5,425,236 probably benign Het
Ankrd24 C CGGAGGCAGAGGA 10: 81,643,571 probably benign Het
Aqp2 T C 15: 99,583,872 S216P probably damaging Het
Cacna1f GGA GGAAGA X: 7,620,056 probably benign Het
Ccdc170 CCA CCAGCA 10: 4,561,018 probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,712,528 probably benign Het
Cela2a T C 4: 141,821,715 N117D probably benign Het
Cul9 CTTC CTTCTTC 17: 46,500,848 probably benign Het
Cyb5r2 A T 7: 107,751,168 S235R probably benign Het
Dnmt1 TT TTTTGGGGGCGGAGCACAGTTCCTACCTCGAT 9: 20,910,144 probably null Het
E4f1 CCG CCGTCG 17: 24,455,186 probably benign Het
Fam171b TCCAGCA TCCAGCACCAGCA 2: 83,812,873 probably benign Het
Fam171b GC GCAGCATC 2: 83,812,895 probably benign Het
Fam81b CTGTT CTGTTGTT 13: 76,271,316 probably benign Het
Fkbp1a GCCGCCGCCA G 2: 151,542,699 probably null Het
Flii G A 11: 60,716,243 A969V probably benign Het
Gas1 G GAAA 13: 60,176,531 probably benign Het
Grip1 A G 10: 119,931,315 D115G probably null Het
Guca2b G T 4: 119,656,847 T89N possibly damaging Het
Hcn4 T A 9: 58,859,915 S920T unknown Het
Heatr1 A G 13: 12,407,544 M484V probably benign Het
Iba57 G T 11: 59,163,612 A27E probably benign Het
Ifi207 G C 1: 173,729,121 L684V not run Het
Ints13 T C 6: 146,556,240 H380R probably damaging Het
Jmjd1c C T 10: 67,220,199 T466I possibly damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Kif12 C CCTCCACCCGGCGGGG 4: 63,171,427 probably benign Het
Kmt2c A T 5: 25,338,459 D1399E probably damaging Het
Macf1 A T 4: 123,473,855 L2371Q probably damaging Het
Mbd1 GTCTTCGTCTGCATCTGCATCTGCATCT GTCT 18: 74,273,610 probably benign Het
Med12l GCA GCATCA 3: 59,275,980 probably benign Het
Mgam C A 6: 40,757,436 Q1472K probably damaging Het
Mup21 TATACTT TATACTTTTTAGATACTT 4: 62,149,345 probably benign Het
Nipal1 A G 5: 72,666,813 N167D probably damaging Het
Olfr1105 T A 2: 87,034,041 Y60F probably damaging Het
Olfr1426 C T 19: 12,088,247 V182I probably benign Het
Osbpl3 CCTGCA C 6: 50,348,138 probably benign Het
Phf20 CCCCCCCCC CCCCCCCCCCCCCCCC 2: 156,304,620 probably benign Het
Phf20 CCCCCCCC CCCCCCCCCCCCCCC 2: 156,304,621 probably benign Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Rbm33 CCAGCCGCAGC CCAGC 5: 28,394,181 probably benign Het
Rubcnl T C 14: 75,044,438 F445S probably damaging Het
S100a10 TTTTTTTA T 3: 93,564,234 probably benign Het
Sbp AA AAAATGCTGACAACGGA 17: 23,945,354 probably benign Het
Sec14l3 A C 11: 4,067,963 Q81P possibly damaging Het
Setd1a TGGTGGTGG TGGTGGTGGGGGTGGTGG 7: 127,785,343 probably benign Het
Six3 CGG CGGGGG 17: 85,621,368 probably benign Het
Snapc5 ATGGAAGAAGAGG A 9: 64,182,211 probably benign Het
Tbc1d12 CGGAGGAGG CGG 19: 38,836,957 probably benign Het
Tcof1 AGC AGCCGC 18: 60,835,739 probably benign Het
Tmem28 CGCCGC CGCCGCAGCCGC X: 99,821,361 probably benign Het
Tox2 A G 2: 163,225,564 I68V probably benign Het
Triml2 G T 8: 43,183,164 probably benign Het
Tspan33 A G 6: 29,716,730 Y162C probably damaging Het
Zfp384 GGCCCAGGCCCA GGCCCAGGCCCAAGCCCAGGCCCA 6: 125,036,476 probably benign Het
Zfp948 T C 17: 21,588,312 Y589H probably damaging Het
Zic1 T C 9: 91,364,330 I230V probably benign Het
Other mutations in A030005L19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
RF001:A030005L19Rik UTSW 1 82913590 small insertion probably benign
RF005:A030005L19Rik UTSW 1 82913585 small insertion probably benign
RF011:A030005L19Rik UTSW 1 82913569 small insertion probably benign
RF011:A030005L19Rik UTSW 1 82913586 small insertion probably benign
RF016:A030005L19Rik UTSW 1 82913577 small insertion probably benign
RF018:A030005L19Rik UTSW 1 82913572 small insertion probably benign
RF021:A030005L19Rik UTSW 1 82913569 small insertion probably benign
RF023:A030005L19Rik UTSW 1 82913396 small deletion probably benign
RF028:A030005L19Rik UTSW 1 82913578 small insertion probably benign
RF028:A030005L19Rik UTSW 1 82913580 small insertion probably benign
RF034:A030005L19Rik UTSW 1 82913580 small insertion probably benign
RF035:A030005L19Rik UTSW 1 82913589 small insertion probably benign
RF038:A030005L19Rik UTSW 1 82913580 small insertion probably benign
RF040:A030005L19Rik UTSW 1 82913577 small insertion probably benign
RF040:A030005L19Rik UTSW 1 82913590 small insertion probably benign
RF042:A030005L19Rik UTSW 1 82913584 small insertion probably benign
RF044:A030005L19Rik UTSW 1 82913589 small insertion probably benign
RF053:A030005L19Rik UTSW 1 82913573 small insertion probably benign
RF059:A030005L19Rik UTSW 1 82913579 small insertion probably benign
RF060:A030005L19Rik UTSW 1 82913396 small deletion probably benign
RF060:A030005L19Rik UTSW 1 82913579 nonsense probably null
RF060:A030005L19Rik UTSW 1 82913587 small insertion probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04