Incidental Mutation 'RF011:Ifi207'
ID603181
Institutional Source Beutler Lab
Gene Symbol Ifi207
Ensembl Gene ENSMUSG00000073490
Gene Nameinterferon activated gene 207
SynonymsPyhin-A, AI607873
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #RF011 (G1)
Quality Score84.0076
Status Not validated
Chromosome1
Chromosomal Location173723427-173741747 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 173729121 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Valine at position 684 (L684V)
Ref Sequence ENSEMBL: ENSMUSP00000119350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127730]
Predicted Effect not run
Transcript: ENSMUST00000127730
AA Change: L684V
SMART Domains Protein: ENSMUSP00000119350
Gene: ENSMUSG00000073490
AA Change: L684V

DomainStartEndE-ValueType
PYRIN 6 84 3.2e-15 SMART
low complexity region 121 133 N/A INTRINSIC
low complexity region 136 155 N/A INTRINSIC
low complexity region 200 208 N/A INTRINSIC
internal_repeat_1 279 465 6.41e-7 PROSPERO
low complexity region 469 489 N/A INTRINSIC
internal_repeat_1 558 775 6.41e-7 PROSPERO
Pfam:HIN 781 948 1.8e-78 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,743,609 K672R possibly damaging Het
A030005L19Rik GTGGTGGCTG GTGGTGGCTGTGGTGGCTG 1: 82,913,569 probably benign Het
A030005L19Rik TGGCTGCTG TGGCTGCTGGGGCTGCTG 1: 82,913,573 probably benign Het
A030005L19Rik TGCTG TGCTGTGGCGGCTG 1: 82,913,586 probably benign Het
AI837181 GCG GCGTCG 19: 5,425,236 probably benign Het
Ankrd24 C CGGAGGCAGAGGA 10: 81,643,571 probably benign Het
Aqp2 T C 15: 99,583,872 S216P probably damaging Het
Cacna1f GGA GGAAGA X: 7,620,056 probably benign Het
Ccdc170 CCA CCAGCA 10: 4,561,018 probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,712,528 probably benign Het
Cela2a T C 4: 141,821,715 N117D probably benign Het
Cul9 CTTC CTTCTTC 17: 46,500,848 probably benign Het
Cyb5r2 A T 7: 107,751,168 S235R probably benign Het
Dnmt1 CACAGTTCCTACCTCGTT CACAGTTCCTACCTCGTTTTGGGGGCGGAGAACAGTTCCTACCTCGTT 9: 20,910,128 probably null Het
Dnmt1 TT TTTTGGGGGCGGAGCACAGTTCCTACCTCGAT 9: 20,910,144 probably null Het
E4f1 CCG CCGTCG 17: 24,455,186 probably benign Het
Fam171b TCCAGCA TCCAGCACCAGCA 2: 83,812,873 probably benign Het
Fam171b GC GCAGCATC 2: 83,812,895 probably benign Het
Fam81b CTGTT CTGTTGTT 13: 76,271,316 probably benign Het
Fkbp1a GCCGCCGCCA G 2: 151,542,699 probably null Het
Flii G A 11: 60,716,243 A969V probably benign Het
Fscb AGTGGAACTTCTGCAGGCCCCTCTTCAGTTAGTGTAGGTGGAACTTCTGCAGGCCCCTCTTCAGTTAGTGGAGGTGGAACTTCTGCAGG AGTGGAACTTCTGCAGGCCCCTCTTCAGTTAGTGGAGGTGGAACTTCTGCAGG 12: 64,472,994 probably benign Het
Gas1 G GAAA 13: 60,176,531 probably benign Het
Grip1 A G 10: 119,931,315 D115G probably null Het
Guca2b G T 4: 119,656,847 T89N possibly damaging Het
Hcn4 T A 9: 58,859,915 S920T unknown Het
Heatr1 A G 13: 12,407,544 M484V probably benign Het
Iba57 G T 11: 59,163,612 A27E probably benign Het
Ints13 T C 6: 146,556,240 H380R probably damaging Het
Jmjd1c C T 10: 67,220,199 T466I possibly damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Kif12 C CCTCCACCCGGCGGGG 4: 63,171,427 probably benign Het
Kmt2c A T 5: 25,338,459 D1399E probably damaging Het
Macf1 A T 4: 123,473,855 L2371Q probably damaging Het
Mbd1 GTCTTCGTCTGCATCTGCATCTGCATCT GTCT 18: 74,273,610 probably benign Het
Med12l GCA GCATCA 3: 59,275,980 probably benign Het
Mgam C A 6: 40,757,436 Q1472K probably damaging Het
Mup21 TATACTT TATACTTTTTAGATACTT 4: 62,149,345 probably benign Het
Nipal1 A G 5: 72,666,813 N167D probably damaging Het
Olfr1105 T A 2: 87,034,041 Y60F probably damaging Het
Olfr1426 C T 19: 12,088,247 V182I probably benign Het
Osbpl3 CCTGCA C 6: 50,348,138 probably benign Het
Phf20 CCCCCCCCC CCCCCCCCCCCCCCCC 2: 156,304,620 probably benign Het
Phf20 CCCCCCCC CCCCCCCCCCCCCCC 2: 156,304,621 probably benign Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Rassf6 TCCTGTAGAGCAATGGGGATTC TCCTGTAGAGCAATGGGGATTCTGCCTCACTCATGGGCCTGTAGAGCAATGGGGATTC 5: 90,608,921 probably benign Het
Rbm33 CCAGCCGCAGC CCAGC 5: 28,394,181 probably benign Het
Rubcnl T C 14: 75,044,438 F445S probably damaging Het
S100a10 TTTTTTTA T 3: 93,564,234 probably benign Het
Sbp AA AAAATGCTGACAACGGA 17: 23,945,354 probably benign Het
Sec14l3 A C 11: 4,067,963 Q81P possibly damaging Het
Setd1a TGGTGGTGG TGGTGGTGGGGGTGGTGG 7: 127,785,343 probably benign Het
Six3 CGG CGGGGG 17: 85,621,368 probably benign Het
Snapc5 ATGGAAGAAGAGG A 9: 64,182,211 probably benign Het
Tbc1d12 CGGAGGAGG CGG 19: 38,836,957 probably benign Het
Tcof1 AGC AGCCGC 18: 60,835,739 probably benign Het
Tmem28 CGCCGC CGCCGCAGCCGC X: 99,821,361 probably benign Het
Tox2 A G 2: 163,225,564 I68V probably benign Het
Triml2 G T 8: 43,183,164 probably benign Het
Tspan33 A G 6: 29,716,730 Y162C probably damaging Het
Zfp384 GGCCCAGGCCCA GGCCCAGGCCCAAGCCCAGGCCCA 6: 125,036,476 probably benign Het
Zfp948 T C 17: 21,588,312 Y589H probably damaging Het
Zic1 T C 9: 91,364,330 I230V probably benign Het
Other mutations in Ifi207
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01776:Ifi207 APN 1 173725044 missense probably damaging 1.00
IGL01864:Ifi207 APN 1 173736441 missense possibly damaging 0.72
IGL02293:Ifi207 APN 1 173723748 missense probably damaging 1.00
IGL02402:Ifi207 APN 1 173727593 missense probably damaging 1.00
IGL03160:Ifi207 APN 1 173735104 splice site probably benign
PIT4458001:Ifi207 UTSW 1 173735172 missense unknown
R0043:Ifi207 UTSW 1 173729112 missense possibly damaging 0.48
R0212:Ifi207 UTSW 1 173736398 missense possibly damaging 0.85
R0395:Ifi207 UTSW 1 173729865 missense possibly damaging 0.85
R0506:Ifi207 UTSW 1 173736312 missense possibly damaging 0.52
R0843:Ifi207 UTSW 1 173727577 missense probably damaging 1.00
R1302:Ifi207 UTSW 1 173735295 missense possibly damaging 0.96
R1373:Ifi207 UTSW 1 173730347 missense unknown
R1462:Ifi207 UTSW 1 173724947 missense probably damaging 1.00
R1462:Ifi207 UTSW 1 173724947 missense probably damaging 1.00
R1471:Ifi207 UTSW 1 173730063 missense unknown
R1502:Ifi207 UTSW 1 173729306 missense possibly damaging 0.56
R1533:Ifi207 UTSW 1 173727740 missense probably benign 0.30
R1831:Ifi207 UTSW 1 173732426 missense unknown
R1928:Ifi207 UTSW 1 173729645 missense possibly damaging 0.68
R1982:Ifi207 UTSW 1 173735239 missense probably benign 0.01
R2132:Ifi207 UTSW 1 173729771 missense possibly damaging 0.84
R2248:Ifi207 UTSW 1 173736470 splice site probably benign
R3703:Ifi207 UTSW 1 173727463 nonsense probably null
R3741:Ifi207 UTSW 1 173727562 missense probably damaging 1.00
R3846:Ifi207 UTSW 1 173735303 missense probably benign 0.33
R4747:Ifi207 UTSW 1 173729067 missense probably benign 0.00
R4772:Ifi207 UTSW 1 173727687 missense probably damaging 1.00
R4776:Ifi207 UTSW 1 173730056 missense unknown
R4855:Ifi207 UTSW 1 173729815 missense probably damaging 0.96
R5170:Ifi207 UTSW 1 173730498 missense unknown
R5244:Ifi207 UTSW 1 173729937 missense probably benign 0.04
R5280:Ifi207 UTSW 1 173730304 missense unknown
R5301:Ifi207 UTSW 1 173729411 missense possibly damaging 0.83
R5334:Ifi207 UTSW 1 173727531 missense probably benign 0.21
R5445:Ifi207 UTSW 1 173727797 missense probably damaging 0.99
R5691:Ifi207 UTSW 1 173732426 missense unknown
R5838:Ifi207 UTSW 1 173732387 missense unknown
R6060:Ifi207 UTSW 1 173730527 missense unknown
R6220:Ifi207 UTSW 1 173729546 missense probably damaging 0.99
R6264:Ifi207 UTSW 1 173727545 missense probably damaging 1.00
R6307:Ifi207 UTSW 1 173725053 missense probably damaging 1.00
R6326:Ifi207 UTSW 1 173729966 missense probably benign 0.01
R6394:Ifi207 UTSW 1 173729015 missense probably benign 0.43
R6532:Ifi207 UTSW 1 173729645 missense possibly damaging 0.68
R6660:Ifi207 UTSW 1 173729406 missense probably benign 0.01
R6893:Ifi207 UTSW 1 173727642 missense possibly damaging 0.95
R7190:Ifi207 UTSW 1 173730252 missense unknown
R7192:Ifi207 UTSW 1 173729018 missense not run
R7194:Ifi207 UTSW 1 173729924 missense possibly damaging 0.84
R7327:Ifi207 UTSW 1 173729015 missense probably benign 0.43
R7348:Ifi207 UTSW 1 173729196 small deletion probably benign
R7404:Ifi207 UTSW 1 173728928 missense possibly damaging 0.92
R7442:Ifi207 UTSW 1 173727431 missense probably benign 0.03
R7784:Ifi207 UTSW 1 173730132 missense unknown
R8041:Ifi207 UTSW 1 173727702 missense possibly damaging 0.78
R8116:Ifi207 UTSW 1 173730180 missense unknown
R8383:Ifi207 UTSW 1 173729204 small deletion probably benign
R8388:Ifi207 UTSW 1 173729450 frame shift probably null
R8389:Ifi207 UTSW 1 173729450 frame shift probably null
R8390:Ifi207 UTSW 1 173729450 frame shift probably null
R8399:Ifi207 UTSW 1 173730278 missense unknown
R8431:Ifi207 UTSW 1 173730504 missense unknown
R8505:Ifi207 UTSW 1 173729450 frame shift probably null
RF009:Ifi207 UTSW 1 173728992 missense probably benign 0.00
RF032:Ifi207 UTSW 1 173735157 small deletion probably benign
X0003:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0004:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0005:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0009:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0010:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0011:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0012:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0013:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0014:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0017:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0018:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0019:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0020:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0021:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0022:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0023:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0024:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0025:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0026:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0027:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0028:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0033:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0034:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0035:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0036:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0037:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0038:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0039:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0040:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0050:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0052:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0053:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0054:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0057:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0058:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0060:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0061:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0062:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0063:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0064:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0065:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0066:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0067:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
Z1177:Ifi207 UTSW 1 173729579 missense probably damaging 1.00
Predicted Primers
Posted On2019-12-04