Incidental Mutation 'RF011:Fam171b'
Institutional Source Beutler Lab
Gene Symbol Fam171b
Ensembl Gene ENSMUSG00000048388
Gene Namefamily with sequence similarity 171, member B
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #RF011 (G1)
Quality Score217.468
Status Not validated
Chromosomal Location83812636-83883486 bp(+) (GRCm38)
Type of Mutationsmall insertion (2 aa in frame mutation)
DNA Base Change (assembly) GC to GCAGCATC at 83812895 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000062702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051454]
Predicted Effect probably benign
Transcript: ENSMUST00000051454
SMART Domains Protein: ENSMUSP00000062702
Gene: ENSMUSG00000048388

signal peptide 1 23 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
Pfam:UPF0560 80 591 4.3e-101 PFAM
Pfam:UPF0560 583 821 6.7e-49 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,743,609 K672R possibly damaging Het
A030005L19Rik GTGGTGGCTG GTGGTGGCTGTGGTGGCTG 1: 82,913,569 probably benign Het
A030005L19Rik TGGCTGCTG TGGCTGCTGGGGCTGCTG 1: 82,913,573 probably benign Het
A030005L19Rik TGCTG TGCTGTGGCGGCTG 1: 82,913,586 probably benign Het
AI837181 GCG GCGTCG 19: 5,425,236 probably benign Het
Ankrd24 C CGGAGGCAGAGGA 10: 81,643,571 probably benign Het
Aqp2 T C 15: 99,583,872 S216P probably damaging Het
Cacna1f GGA GGAAGA X: 7,620,056 probably benign Het
Ccdc170 CCA CCAGCA 10: 4,561,018 probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,712,528 probably benign Het
Cela2a T C 4: 141,821,715 N117D probably benign Het
Cul9 CTTC CTTCTTC 17: 46,500,848 probably benign Het
Cyb5r2 A T 7: 107,751,168 S235R probably benign Het
Dnmt1 TT TTTTGGGGGCGGAGCACAGTTCCTACCTCGAT 9: 20,910,144 probably null Het
E4f1 CCG CCGTCG 17: 24,455,186 probably benign Het
Fam81b CTGTT CTGTTGTT 13: 76,271,316 probably benign Het
Fkbp1a GCCGCCGCCA G 2: 151,542,699 probably null Het
Flii G A 11: 60,716,243 A969V probably benign Het
Gas1 G GAAA 13: 60,176,531 probably benign Het
Grip1 A G 10: 119,931,315 D115G probably null Het
Guca2b G T 4: 119,656,847 T89N possibly damaging Het
Hcn4 T A 9: 58,859,915 S920T unknown Het
Heatr1 A G 13: 12,407,544 M484V probably benign Het
Iba57 G T 11: 59,163,612 A27E probably benign Het
Ifi207 G C 1: 173,729,121 L684V not run Het
Ints13 T C 6: 146,556,240 H380R probably damaging Het
Jmjd1c C T 10: 67,220,199 T466I possibly damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Kif12 C CCTCCACCCGGCGGGG 4: 63,171,427 probably benign Het
Kmt2c A T 5: 25,338,459 D1399E probably damaging Het
Macf1 A T 4: 123,473,855 L2371Q probably damaging Het
Mbd1 GTCTTCGTCTGCATCTGCATCTGCATCT GTCT 18: 74,273,610 probably benign Het
Med12l GCA GCATCA 3: 59,275,980 probably benign Het
Mgam C A 6: 40,757,436 Q1472K probably damaging Het
Mup21 TATACTT TATACTTTTTAGATACTT 4: 62,149,345 probably benign Het
Nipal1 A G 5: 72,666,813 N167D probably damaging Het
Olfr1105 T A 2: 87,034,041 Y60F probably damaging Het
Olfr1426 C T 19: 12,088,247 V182I probably benign Het
Osbpl3 CCTGCA C 6: 50,348,138 probably benign Het
Phf20 CCCCCCCCC CCCCCCCCCCCCCCCC 2: 156,304,620 probably benign Het
Phf20 CCCCCCCC CCCCCCCCCCCCCCC 2: 156,304,621 probably benign Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Rbm33 CCAGCCGCAGC CCAGC 5: 28,394,181 probably benign Het
Rubcnl T C 14: 75,044,438 F445S probably damaging Het
S100a10 TTTTTTTA T 3: 93,564,234 probably benign Het
Sbp AA AAAATGCTGACAACGGA 17: 23,945,354 probably benign Het
Sec14l3 A C 11: 4,067,963 Q81P possibly damaging Het
Setd1a TGGTGGTGG TGGTGGTGGGGGTGGTGG 7: 127,785,343 probably benign Het
Six3 CGG CGGGGG 17: 85,621,368 probably benign Het
Snapc5 ATGGAAGAAGAGG A 9: 64,182,211 probably benign Het
Tbc1d12 CGGAGGAGG CGG 19: 38,836,957 probably benign Het
Tcof1 AGC AGCCGC 18: 60,835,739 probably benign Het
Tmem28 CGCCGC CGCCGCAGCCGC X: 99,821,361 probably benign Het
Tox2 A G 2: 163,225,564 I68V probably benign Het
Triml2 G T 8: 43,183,164 probably benign Het
Tspan33 A G 6: 29,716,730 Y162C probably damaging Het
Zfp384 GGCCCAGGCCCA GGCCCAGGCCCAAGCCCAGGCCCA 6: 125,036,476 probably benign Het
Zfp948 T C 17: 21,588,312 Y589H probably damaging Het
Zic1 T C 9: 91,364,330 I230V probably benign Het
Other mutations in Fam171b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Fam171b APN 2 83876728 nonsense probably null
IGL01309:Fam171b APN 2 83879447 nonsense probably null
IGL01515:Fam171b APN 2 83880233 missense probably damaging 0.99
IGL01604:Fam171b APN 2 83879600 missense possibly damaging 0.50
IGL01729:Fam171b APN 2 83855537 splice site probably benign
IGL01784:Fam171b APN 2 83879687 missense possibly damaging 0.83
P0028:Fam171b UTSW 2 83853439 missense probably damaging 1.00
R1203:Fam171b UTSW 2 83812969 missense probably benign 0.05
R1530:Fam171b UTSW 2 83880189 missense probably damaging 1.00
R1539:Fam171b UTSW 2 83880098 missense probably benign 0.00
R1564:Fam171b UTSW 2 83880284 missense probably damaging 1.00
R1858:Fam171b UTSW 2 83853381 missense probably benign
R1940:Fam171b UTSW 2 83812874 small deletion probably benign
R2131:Fam171b UTSW 2 83879858 missense probably damaging 0.97
R3746:Fam171b UTSW 2 83879600 missense probably damaging 1.00
R3777:Fam171b UTSW 2 83878261 missense probably benign 0.03
R3840:Fam171b UTSW 2 83880062 missense possibly damaging 0.76
R4920:Fam171b UTSW 2 83880359 missense possibly damaging 0.73
R5007:Fam171b UTSW 2 83855509 nonsense probably null
R5178:Fam171b UTSW 2 83879987 missense probably damaging 1.00
R5282:Fam171b UTSW 2 83853605 critical splice donor site probably null
R5544:Fam171b UTSW 2 83855527 missense possibly damaging 0.58
R5614:Fam171b UTSW 2 83812873 missense probably damaging 0.99
R5786:Fam171b UTSW 2 83878236 missense probably benign 0.38
R6190:Fam171b UTSW 2 83876698 missense probably benign
R6247:Fam171b UTSW 2 83879208 missense probably damaging 1.00
R6309:Fam171b UTSW 2 83860460 missense probably damaging 0.99
R6324:Fam171b UTSW 2 83879264 nonsense probably null
R7127:Fam171b UTSW 2 83879766 missense probably benign 0.25
R7201:Fam171b UTSW 2 83878230 missense probably damaging 1.00
R7223:Fam171b UTSW 2 83878230 missense probably damaging 1.00
R7689:Fam171b UTSW 2 83879388 missense probably benign 0.38
R7904:Fam171b UTSW 2 83853505 missense probably damaging 0.97
R8069:Fam171b UTSW 2 83812874 small deletion probably benign
R8236:Fam171b UTSW 2 83880206 missense probably damaging 0.97
R8252:Fam171b UTSW 2 83878242 missense probably benign 0.00
R8458:Fam171b UTSW 2 83860520 missense probably benign 0.21
RF001:Fam171b UTSW 2 83812886 small insertion probably benign
RF009:Fam171b UTSW 2 83812880 small insertion probably benign
RF011:Fam171b UTSW 2 83812873 small insertion probably benign
RF013:Fam171b UTSW 2 83812895 small insertion probably benign
RF027:Fam171b UTSW 2 83812876 small insertion probably benign
RF029:Fam171b UTSW 2 83812892 small insertion probably benign
RF036:Fam171b UTSW 2 83812892 small insertion probably benign
RF055:Fam171b UTSW 2 83812876 small insertion probably benign
RF056:Fam171b UTSW 2 83812896 small insertion probably benign
RF060:Fam171b UTSW 2 83812877 small insertion probably benign
RF063:Fam171b UTSW 2 83812896 small insertion probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04