Incidental Mutation 'RF011:Olfr1105'
ID603184
Institutional Source Beutler Lab
Gene Symbol Olfr1105
Ensembl Gene ENSMUSG00000075165
Gene Nameolfactory receptor 1105
SynonymsMOR172-7, MOR0-6P, GA_x6K02T2Q125-48521031-48520093
Accession Numbers

Genbank: NM_001011825; MGI: 3030939

Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #RF011 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location87031260-87036531 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87034041 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 60 (Y60F)
Ref Sequence ENSEMBL: ENSMUSP00000149148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099868] [ENSMUST00000215978]
Predicted Effect probably damaging
Transcript: ENSMUST00000099868
AA Change: Y60F

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097453
Gene: ENSMUSG00000075165
AA Change: Y60F

DomainStartEndE-ValueType
Pfam:7tm_4 30 308 5.2e-47 PFAM
Pfam:7TM_GPCR_Srsx 35 305 5.5e-6 PFAM
Pfam:7tm_1 41 308 5.2e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215978
AA Change: Y60F

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,743,609 K672R possibly damaging Het
A030005L19Rik GTGGTGGCTG GTGGTGGCTGTGGTGGCTG 1: 82,913,569 probably benign Het
A030005L19Rik TGGCTGCTG TGGCTGCTGGGGCTGCTG 1: 82,913,573 probably benign Het
A030005L19Rik TGCTG TGCTGTGGCGGCTG 1: 82,913,586 probably benign Het
AI837181 GCG GCGTCG 19: 5,425,236 probably benign Het
Ankrd24 C CGGAGGCAGAGGA 10: 81,643,571 probably benign Het
Aqp2 T C 15: 99,583,872 S216P probably damaging Het
Cacna1f GGA GGAAGA X: 7,620,056 probably benign Het
Ccdc170 CCA CCAGCA 10: 4,561,018 probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,712,528 probably benign Het
Cela2a T C 4: 141,821,715 N117D probably benign Het
Cul9 CTTC CTTCTTC 17: 46,500,848 probably benign Het
Cyb5r2 A T 7: 107,751,168 S235R probably benign Het
Dnmt1 CACAGTTCCTACCTCGTT CACAGTTCCTACCTCGTTTTGGGGGCGGAGAACAGTTCCTACCTCGTT 9: 20,910,128 probably null Het
Dnmt1 TT TTTTGGGGGCGGAGCACAGTTCCTACCTCGAT 9: 20,910,144 probably null Het
E4f1 CCG CCGTCG 17: 24,455,186 probably benign Het
Fam171b TCCAGCA TCCAGCACCAGCA 2: 83,812,873 probably benign Het
Fam171b GC GCAGCATC 2: 83,812,895 probably benign Het
Fam81b CTGTT CTGTTGTT 13: 76,271,316 probably benign Het
Fkbp1a GCCGCCGCCA G 2: 151,542,699 probably null Het
Flii G A 11: 60,716,243 A969V probably benign Het
Fscb AGTGGAACTTCTGCAGGCCCCTCTTCAGTTAGTGTAGGTGGAACTTCTGCAGGCCCCTCTTCAGTTAGTGGAGGTGGAACTTCTGCAGG AGTGGAACTTCTGCAGGCCCCTCTTCAGTTAGTGGAGGTGGAACTTCTGCAGG 12: 64,472,994 probably benign Het
Gas1 G GAAA 13: 60,176,531 probably benign Het
Grip1 A G 10: 119,931,315 D115G probably null Het
Guca2b G T 4: 119,656,847 T89N possibly damaging Het
Hcn4 T A 9: 58,859,915 S920T unknown Het
Heatr1 A G 13: 12,407,544 M484V probably benign Het
Iba57 G T 11: 59,163,612 A27E probably benign Het
Ifi207 G C 1: 173,729,121 L684V not run Het
Ints13 T C 6: 146,556,240 H380R probably damaging Het
Jmjd1c C T 10: 67,220,199 T466I possibly damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Kif12 C CCTCCACCCGGCGGGG 4: 63,171,427 probably benign Het
Kmt2c A T 5: 25,338,459 D1399E probably damaging Het
Macf1 A T 4: 123,473,855 L2371Q probably damaging Het
Mbd1 GTCTTCGTCTGCATCTGCATCTGCATCT GTCT 18: 74,273,610 probably benign Het
Med12l GCA GCATCA 3: 59,275,980 probably benign Het
Mgam C A 6: 40,757,436 Q1472K probably damaging Het
Mup21 TATACTT TATACTTTTTAGATACTT 4: 62,149,345 probably benign Het
Nipal1 A G 5: 72,666,813 N167D probably damaging Het
Olfr1426 C T 19: 12,088,247 V182I probably benign Het
Osbpl3 CCTGCA C 6: 50,348,138 probably benign Het
Phf20 CCCCCCCCC CCCCCCCCCCCCCCCC 2: 156,304,620 probably benign Het
Phf20 CCCCCCCC CCCCCCCCCCCCCCC 2: 156,304,621 probably benign Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Rassf6 TCCTGTAGAGCAATGGGGATTC TCCTGTAGAGCAATGGGGATTCTGCCTCACTCATGGGCCTGTAGAGCAATGGGGATTC 5: 90,608,921 probably benign Het
Rbm33 CCAGCCGCAGC CCAGC 5: 28,394,181 probably benign Het
Rubcnl T C 14: 75,044,438 F445S probably damaging Het
S100a10 TTTTTTTA T 3: 93,564,234 probably benign Het
Sbp AA AAAATGCTGACAACGGA 17: 23,945,354 probably benign Het
Sec14l3 A C 11: 4,067,963 Q81P possibly damaging Het
Setd1a TGGTGGTGG TGGTGGTGGGGGTGGTGG 7: 127,785,343 probably benign Het
Six3 CGG CGGGGG 17: 85,621,368 probably benign Het
Snapc5 ATGGAAGAAGAGG A 9: 64,182,211 probably benign Het
Tbc1d12 CGGAGGAGG CGG 19: 38,836,957 probably benign Het
Tcof1 AGC AGCCGC 18: 60,835,739 probably benign Het
Tmem28 CGCCGC CGCCGCAGCCGC X: 99,821,361 probably benign Het
Tox2 A G 2: 163,225,564 I68V probably benign Het
Triml2 G T 8: 43,183,164 probably benign Het
Tspan33 A G 6: 29,716,730 Y162C probably damaging Het
Zfp384 GGCCCAGGCCCA GGCCCAGGCCCAAGCCCAGGCCCA 6: 125,036,476 probably benign Het
Zfp948 T C 17: 21,588,312 Y589H probably damaging Het
Zic1 T C 9: 91,364,330 I230V probably benign Het
Other mutations in Olfr1105
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01673:Olfr1105 APN 2 87033387 missense probably damaging 1.00
IGL02029:Olfr1105 APN 2 87033901 missense probably benign 0.00
IGL02332:Olfr1105 APN 2 87034212 missense probably benign 0.32
3-1:Olfr1105 UTSW 2 87033684 missense probably damaging 1.00
R0060:Olfr1105 UTSW 2 87033774 missense probably damaging 1.00
R0060:Olfr1105 UTSW 2 87033774 missense probably damaging 1.00
R0100:Olfr1105 UTSW 2 87033595 missense probably benign 0.01
R0100:Olfr1105 UTSW 2 87033595 missense probably benign 0.01
R0417:Olfr1105 UTSW 2 87033445 missense probably damaging 0.99
R0573:Olfr1105 UTSW 2 87033468 missense probably damaging 1.00
R0589:Olfr1105 UTSW 2 87034115 nonsense probably null
R0630:Olfr1105 UTSW 2 87033309 missense probably benign 0.05
R0690:Olfr1105 UTSW 2 87033882 missense probably damaging 1.00
R3929:Olfr1105 UTSW 2 87034084 missense possibly damaging 0.88
R4563:Olfr1105 UTSW 2 87033684 missense probably damaging 1.00
R4718:Olfr1105 UTSW 2 87033895 missense probably damaging 0.99
R6362:Olfr1105 UTSW 2 87033289 missense probably benign 0.11
Z1176:Olfr1105 UTSW 2 87033487 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCTGTAGTAAAGCGGACTGC -3'
(R):5'- TGGCTGACAGAAATCTGACTG -3'

Sequencing Primer
(F):5'- GATACCGATCATAGGCCATTGCAG -3'
(R):5'- GCTGACAGAAATCTGACTGTGATAAC -3'
Posted On2019-12-04