Incidental Mutation 'RF011:Pramef25'
Institutional Source Beutler Lab
Gene Symbol Pramef25
Ensembl Gene ENSMUSG00000078511
Gene NamePRAME family member 25
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #RF011 (G1)
Quality Score225.009
Status Not validated
Chromosomal Location143948580-143951016 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 143948908 bp
Amino Acid Change Glutamine to Histidine at position 449 (Q449H)
Ref Sequence ENSEMBL: ENSMUSP00000101392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105766]
Predicted Effect probably damaging
Transcript: ENSMUST00000105766
AA Change: Q449H

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101392
Gene: ENSMUSG00000078511
AA Change: Q449H

SCOP:d1a4ya_ 223 427 2e-10 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,743,609 K672R possibly damaging Het
A030005L19Rik GTGGTGGCTG GTGGTGGCTGTGGTGGCTG 1: 82,913,569 probably benign Het
A030005L19Rik TGGCTGCTG TGGCTGCTGGGGCTGCTG 1: 82,913,573 probably benign Het
A030005L19Rik TGCTG TGCTGTGGCGGCTG 1: 82,913,586 probably benign Het
AI837181 GCG GCGTCG 19: 5,425,236 probably benign Het
Ankrd24 C CGGAGGCAGAGGA 10: 81,643,571 probably benign Het
Aqp2 T C 15: 99,583,872 S216P probably damaging Het
Cacna1f GGA GGAAGA X: 7,620,056 probably benign Het
Ccdc170 CCA CCAGCA 10: 4,561,018 probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,712,528 probably benign Het
Cela2a T C 4: 141,821,715 N117D probably benign Het
Cul9 CTTC CTTCTTC 17: 46,500,848 probably benign Het
Cyb5r2 A T 7: 107,751,168 S235R probably benign Het
Dnmt1 TT TTTTGGGGGCGGAGCACAGTTCCTACCTCGAT 9: 20,910,144 probably null Het
E4f1 CCG CCGTCG 17: 24,455,186 probably benign Het
Fam171b TCCAGCA TCCAGCACCAGCA 2: 83,812,873 probably benign Het
Fam171b GC GCAGCATC 2: 83,812,895 probably benign Het
Fam81b CTGTT CTGTTGTT 13: 76,271,316 probably benign Het
Fkbp1a GCCGCCGCCA G 2: 151,542,699 probably null Het
Flii G A 11: 60,716,243 A969V probably benign Het
Gas1 G GAAA 13: 60,176,531 probably benign Het
Grip1 A G 10: 119,931,315 D115G probably null Het
Guca2b G T 4: 119,656,847 T89N possibly damaging Het
Hcn4 T A 9: 58,859,915 S920T unknown Het
Heatr1 A G 13: 12,407,544 M484V probably benign Het
Iba57 G T 11: 59,163,612 A27E probably benign Het
Ifi207 G C 1: 173,729,121 L684V not run Het
Ints13 T C 6: 146,556,240 H380R probably damaging Het
Jmjd1c C T 10: 67,220,199 T466I possibly damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Kif12 C CCTCCACCCGGCGGGG 4: 63,171,427 probably benign Het
Kmt2c A T 5: 25,338,459 D1399E probably damaging Het
Macf1 A T 4: 123,473,855 L2371Q probably damaging Het
Mbd1 GTCTTCGTCTGCATCTGCATCTGCATCT GTCT 18: 74,273,610 probably benign Het
Med12l GCA GCATCA 3: 59,275,980 probably benign Het
Mgam C A 6: 40,757,436 Q1472K probably damaging Het
Mup21 TATACTT TATACTTTTTAGATACTT 4: 62,149,345 probably benign Het
Nipal1 A G 5: 72,666,813 N167D probably damaging Het
Olfr1105 T A 2: 87,034,041 Y60F probably damaging Het
Olfr1426 C T 19: 12,088,247 V182I probably benign Het
Osbpl3 CCTGCA C 6: 50,348,138 probably benign Het
Phf20 CCCCCCCCC CCCCCCCCCCCCCCCC 2: 156,304,620 probably benign Het
Phf20 CCCCCCCC CCCCCCCCCCCCCCC 2: 156,304,621 probably benign Het
Rbm33 CCAGCCGCAGC CCAGC 5: 28,394,181 probably benign Het
Rubcnl T C 14: 75,044,438 F445S probably damaging Het
S100a10 TTTTTTTA T 3: 93,564,234 probably benign Het
Sbp AA AAAATGCTGACAACGGA 17: 23,945,354 probably benign Het
Sec14l3 A C 11: 4,067,963 Q81P possibly damaging Het
Setd1a TGGTGGTGG TGGTGGTGGGGGTGGTGG 7: 127,785,343 probably benign Het
Six3 CGG CGGGGG 17: 85,621,368 probably benign Het
Snapc5 ATGGAAGAAGAGG A 9: 64,182,211 probably benign Het
Tbc1d12 CGGAGGAGG CGG 19: 38,836,957 probably benign Het
Tcof1 AGC AGCCGC 18: 60,835,739 probably benign Het
Tmem28 CGCCGC CGCCGCAGCCGC X: 99,821,361 probably benign Het
Tox2 A G 2: 163,225,564 I68V probably benign Het
Triml2 G T 8: 43,183,164 probably benign Het
Tspan33 A G 6: 29,716,730 Y162C probably damaging Het
Zfp384 GGCCCAGGCCCA GGCCCAGGCCCAAGCCCAGGCCCA 6: 125,036,476 probably benign Het
Zfp948 T C 17: 21,588,312 Y589H probably damaging Het
Zic1 T C 9: 91,364,330 I230V probably benign Het
Other mutations in Pramef25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Pramef25 APN 4 143950214 splice site probably benign
IGL01562:Pramef25 APN 4 143950865 missense probably damaging 1.00
IGL02422:Pramef25 APN 4 143949883 missense probably benign 0.25
IGL02632:Pramef25 APN 4 143949937 missense possibly damaging 0.84
IGL02745:Pramef25 APN 4 143950724 missense probably damaging 1.00
IGL02808:Pramef25 APN 4 143951015 utr 5 prime probably benign
IGL02883:Pramef25 APN 4 143949848 missense possibly damaging 0.64
IGL02961:Pramef25 APN 4 143949147 missense probably damaging 1.00
IGL03092:Pramef25 APN 4 143950197 missense probably damaging 0.97
FR4340:Pramef25 UTSW 4 143949742 missense probably damaging 0.99
FR4342:Pramef25 UTSW 4 143949742 missense probably damaging 0.99
FR4342:Pramef25 UTSW 4 143949757 frame shift probably null
R0533:Pramef25 UTSW 4 143950720 missense possibly damaging 0.85
R0606:Pramef25 UTSW 4 143949883 missense probably benign 0.25
R1624:Pramef25 UTSW 4 143949830 missense possibly damaging 0.47
R1898:Pramef25 UTSW 4 143950728 missense probably damaging 1.00
R2029:Pramef25 UTSW 4 143949883 missense probably benign 0.25
R2867:Pramef25 UTSW 4 143948886 missense probably benign 0.00
R2867:Pramef25 UTSW 4 143948886 missense probably benign 0.00
R2894:Pramef25 UTSW 4 143949122 missense probably damaging 1.00
R4111:Pramef25 UTSW 4 143949905 missense possibly damaging 0.93
R4298:Pramef25 UTSW 4 143949143 nonsense probably null
R4360:Pramef25 UTSW 4 143950863 missense possibly damaging 0.81
R4361:Pramef25 UTSW 4 143950863 missense possibly damaging 0.81
R5137:Pramef25 UTSW 4 143949120 missense probably benign 0.08
R5195:Pramef25 UTSW 4 143950880 missense probably damaging 0.99
R5312:Pramef25 UTSW 4 143949095 missense possibly damaging 0.96
R5548:Pramef25 UTSW 4 143949980 missense probably benign 0.24
R5591:Pramef25 UTSW 4 143948807 missense probably damaging 1.00
R5644:Pramef25 UTSW 4 143948804 missense probably benign 0.01
R6018:Pramef25 UTSW 4 143950899 missense possibly damaging 0.61
R6177:Pramef25 UTSW 4 143949006 missense possibly damaging 0.51
R6335:Pramef25 UTSW 4 143949032 missense probably benign 0.02
R6376:Pramef25 UTSW 4 143950697 missense probably benign 0.03
R6572:Pramef25 UTSW 4 143949692 missense probably benign 0.01
R6845:Pramef25 UTSW 4 143949824 missense probably benign
R6939:Pramef25 UTSW 4 143948796 missense probably benign 0.09
R7081:Pramef25 UTSW 4 143949278 missense probably damaging 1.00
R7505:Pramef25 UTSW 4 143949703 missense possibly damaging 0.94
R7711:Pramef25 UTSW 4 143949252 missense probably benign 0.22
R8284:Pramef25 UTSW 4 143950125 missense possibly damaging 0.95
R8297:Pramef25 UTSW 4 143949120 missense probably benign 0.08
R8299:Pramef25 UTSW 4 143950757 missense probably benign 0.24
RF013:Pramef25 UTSW 4 143948908 missense probably damaging 0.96
RF021:Pramef25 UTSW 4 143948908 missense probably damaging 0.96
Z1176:Pramef25 UTSW 4 143950123 missense probably benign 0.13
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04