Incidental Mutation 'RF011:Mgam'
ID603202
Institutional Source Beutler Lab
Gene Symbol Mgam
Ensembl Gene ENSMUSG00000068587
Gene Namemaltase-glucoamylase
Synonyms6030407P20Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #RF011 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location40628831-40769123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 40757436 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 1472 (Q1472K)
Ref Sequence ENSEMBL: ENSMUSP00000071466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071535] [ENSMUST00000201148] [ENSMUST00000202779] [ENSMUST00000202966]
Predicted Effect probably damaging
Transcript: ENSMUST00000071535
AA Change: Q1472K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071466
Gene: ENSMUSG00000068587
AA Change: Q1472K

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
PD 63 111 1.81e-8 SMART
Pfam:NtCtMGAM_N 124 233 6.2e-36 PFAM
Pfam:Glyco_hydro_31 323 795 3.4e-145 PFAM
PD 924 977 4.52e-9 SMART
Pfam:NtCtMGAM_N 988 1101 1.5e-30 PFAM
Blast:ANK 1141 1171 1e-7 BLAST
Pfam:Glyco_hydro_31 1189 1691 2e-139 PFAM
low complexity region 1776 1791 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201148
AA Change: Q1472K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143946
Gene: ENSMUSG00000068587
AA Change: Q1472K

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
PD 63 111 1.81e-8 SMART
Pfam:NtCtMGAM_N 124 233 6.2e-36 PFAM
Pfam:Glyco_hydro_31 323 795 3.4e-145 PFAM
PD 924 977 4.52e-9 SMART
Pfam:NtCtMGAM_N 988 1101 1.5e-30 PFAM
Blast:ANK 1141 1171 1e-7 BLAST
Pfam:Glyco_hydro_31 1189 1691 2e-139 PFAM
low complexity region 1776 1791 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202779
AA Change: Q845K

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144627
Gene: ENSMUSG00000068587
AA Change: Q845K

DomainStartEndE-ValueType
Pfam:Glyco_hydro_31 2 170 1.4e-53 PFAM
PD 297 350 1.4e-14 SMART
Pfam:NtCtMGAM_N 361 474 1.5e-26 PFAM
Blast:ANK 514 544 7e-8 BLAST
Pfam:Glyco_hydro_31 562 1064 2.2e-137 PFAM
low complexity region 1149 1164 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202966
AA Change: Q726K

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144680
Gene: ENSMUSG00000068587
AA Change: Q726K

DomainStartEndE-ValueType
internal_repeat_1 2 88 2.6e-19 PROSPERO
PD 178 231 1.4e-14 SMART
Pfam:NtCtMGAM_N 242 355 1.1e-26 PFAM
Blast:ANK 395 425 6e-8 BLAST
Pfam:Glyco_hydro_31 443 945 1.3e-137 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes maltase-glucoamylase, which is a brush border membrane enzyme that plays a role in the final steps of digestion of starch. The protein has two catalytic sites identical to those of sucrase-isomaltase, but the proteins are only 59% homologous. Both are members of glycosyl hydrolase family 31, which has a variety of substrate specificities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display abnormalities in starch digestion and prandial glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,743,609 K672R possibly damaging Het
A030005L19Rik GTGGTGGCTG GTGGTGGCTGTGGTGGCTG 1: 82,913,569 probably benign Het
A030005L19Rik TGGCTGCTG TGGCTGCTGGGGCTGCTG 1: 82,913,573 probably benign Het
A030005L19Rik TGCTG TGCTGTGGCGGCTG 1: 82,913,586 probably benign Het
AI837181 GCG GCGTCG 19: 5,425,236 probably benign Het
Ankrd24 C CGGAGGCAGAGGA 10: 81,643,571 probably benign Het
Aqp2 T C 15: 99,583,872 S216P probably damaging Het
Cacna1f GGA GGAAGA X: 7,620,056 probably benign Het
Ccdc170 CCA CCAGCA 10: 4,561,018 probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,712,528 probably benign Het
Cela2a T C 4: 141,821,715 N117D probably benign Het
Cul9 CTTC CTTCTTC 17: 46,500,848 probably benign Het
Cyb5r2 A T 7: 107,751,168 S235R probably benign Het
Dnmt1 CACAGTTCCTACCTCGTT CACAGTTCCTACCTCGTTTTGGGGGCGGAGAACAGTTCCTACCTCGTT 9: 20,910,128 probably null Het
Dnmt1 TT TTTTGGGGGCGGAGCACAGTTCCTACCTCGAT 9: 20,910,144 probably null Het
E4f1 CCG CCGTCG 17: 24,455,186 probably benign Het
Fam171b TCCAGCA TCCAGCACCAGCA 2: 83,812,873 probably benign Het
Fam171b GC GCAGCATC 2: 83,812,895 probably benign Het
Fam81b CTGTT CTGTTGTT 13: 76,271,316 probably benign Het
Fkbp1a GCCGCCGCCA G 2: 151,542,699 probably null Het
Flii G A 11: 60,716,243 A969V probably benign Het
Fscb AGTGGAACTTCTGCAGGCCCCTCTTCAGTTAGTGTAGGTGGAACTTCTGCAGGCCCCTCTTCAGTTAGTGGAGGTGGAACTTCTGCAGG AGTGGAACTTCTGCAGGCCCCTCTTCAGTTAGTGGAGGTGGAACTTCTGCAGG 12: 64,472,994 probably benign Het
Gas1 G GAAA 13: 60,176,531 probably benign Het
Grip1 A G 10: 119,931,315 D115G probably null Het
Guca2b G T 4: 119,656,847 T89N possibly damaging Het
Hcn4 T A 9: 58,859,915 S920T unknown Het
Heatr1 A G 13: 12,407,544 M484V probably benign Het
Iba57 G T 11: 59,163,612 A27E probably benign Het
Ifi207 G C 1: 173,729,121 L684V not run Het
Ints13 T C 6: 146,556,240 H380R probably damaging Het
Jmjd1c C T 10: 67,220,199 T466I possibly damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Kif12 C CCTCCACCCGGCGGGG 4: 63,171,427 probably benign Het
Kmt2c A T 5: 25,338,459 D1399E probably damaging Het
Macf1 A T 4: 123,473,855 L2371Q probably damaging Het
Mbd1 GTCTTCGTCTGCATCTGCATCTGCATCT GTCT 18: 74,273,610 probably benign Het
Med12l GCA GCATCA 3: 59,275,980 probably benign Het
Mup21 TATACTT TATACTTTTTAGATACTT 4: 62,149,345 probably benign Het
Nipal1 A G 5: 72,666,813 N167D probably damaging Het
Olfr1105 T A 2: 87,034,041 Y60F probably damaging Het
Olfr1426 C T 19: 12,088,247 V182I probably benign Het
Osbpl3 CCTGCA C 6: 50,348,138 probably benign Het
Phf20 CCCCCCCCC CCCCCCCCCCCCCCCC 2: 156,304,620 probably benign Het
Phf20 CCCCCCCC CCCCCCCCCCCCCCC 2: 156,304,621 probably benign Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Rassf6 TCCTGTAGAGCAATGGGGATTC TCCTGTAGAGCAATGGGGATTCTGCCTCACTCATGGGCCTGTAGAGCAATGGGGATTC 5: 90,608,921 probably benign Het
Rbm33 CCAGCCGCAGC CCAGC 5: 28,394,181 probably benign Het
Rubcnl T C 14: 75,044,438 F445S probably damaging Het
S100a10 TTTTTTTA T 3: 93,564,234 probably benign Het
Sbp AA AAAATGCTGACAACGGA 17: 23,945,354 probably benign Het
Sec14l3 A C 11: 4,067,963 Q81P possibly damaging Het
Setd1a TGGTGGTGG TGGTGGTGGGGGTGGTGG 7: 127,785,343 probably benign Het
Six3 CGG CGGGGG 17: 85,621,368 probably benign Het
Snapc5 ATGGAAGAAGAGG A 9: 64,182,211 probably benign Het
Tbc1d12 CGGAGGAGG CGG 19: 38,836,957 probably benign Het
Tcof1 AGC AGCCGC 18: 60,835,739 probably benign Het
Tmem28 CGCCGC CGCCGCAGCCGC X: 99,821,361 probably benign Het
Tox2 A G 2: 163,225,564 I68V probably benign Het
Triml2 G T 8: 43,183,164 probably benign Het
Tspan33 A G 6: 29,716,730 Y162C probably damaging Het
Zfp384 GGCCCAGGCCCA GGCCCAGGCCCAAGCCCAGGCCCA 6: 125,036,476 probably benign Het
Zfp948 T C 17: 21,588,312 Y589H probably damaging Het
Zic1 T C 9: 91,364,330 I230V probably benign Het
Other mutations in Mgam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Mgam APN 6 40643010 missense probably benign
IGL01065:Mgam APN 6 40662710 critical splice donor site probably null
IGL01402:Mgam APN 6 40644945 missense probably benign 0.01
IGL01404:Mgam APN 6 40644945 missense probably benign 0.01
IGL01413:Mgam APN 6 40661277 missense probably damaging 1.00
IGL01546:Mgam APN 6 40654693 missense probably damaging 0.98
IGL01596:Mgam APN 6 40658270 missense probably damaging 1.00
IGL02133:Mgam APN 6 40643076 missense probably damaging 0.98
IGL02734:Mgam APN 6 40662694 missense probably damaging 1.00
BB002:Mgam UTSW 6 40759051 missense probably damaging 0.99
BB012:Mgam UTSW 6 40759051 missense probably damaging 0.99
R0012:Mgam UTSW 6 40765256 splice site probably null
R0116:Mgam UTSW 6 40658987 missense probably damaging 1.00
R0310:Mgam UTSW 6 40761035 splice site probably benign
R0452:Mgam UTSW 6 40759090 missense probably damaging 1.00
R0497:Mgam UTSW 6 40664892 missense probably damaging 1.00
R0699:Mgam UTSW 6 40643019 missense possibly damaging 0.84
R0738:Mgam UTSW 6 40754935 missense probably benign 0.01
R1033:Mgam UTSW 6 40680624 missense probably benign 0.07
R1403:Mgam UTSW 6 40666881 missense possibly damaging 0.93
R1403:Mgam UTSW 6 40666881 missense possibly damaging 0.93
R1430:Mgam UTSW 6 40756371 missense probably benign 0.08
R1432:Mgam UTSW 6 40756367 missense probably damaging 1.00
R1443:Mgam UTSW 6 40759780 nonsense probably null
R1470:Mgam UTSW 6 40759128 missense probably damaging 1.00
R1470:Mgam UTSW 6 40759128 missense probably damaging 1.00
R1519:Mgam UTSW 6 40661683 missense probably benign 0.45
R1654:Mgam UTSW 6 40757487 missense probably damaging 1.00
R1667:Mgam UTSW 6 40677044 missense possibly damaging 0.62
R1730:Mgam UTSW 6 40664860 missense possibly damaging 0.92
R1781:Mgam UTSW 6 40669863 missense probably damaging 1.00
R1783:Mgam UTSW 6 40664860 missense possibly damaging 0.92
R1829:Mgam UTSW 6 40666892 missense probably damaging 1.00
R1833:Mgam UTSW 6 40654718 critical splice donor site probably null
R1872:Mgam UTSW 6 40661300 nonsense probably null
R1912:Mgam UTSW 6 40764185 nonsense probably null
R1977:Mgam UTSW 6 40664880 missense probably benign 0.01
R2048:Mgam UTSW 6 40656429 missense possibly damaging 0.80
R2086:Mgam UTSW 6 40761028 splice site probably null
R2138:Mgam UTSW 6 40756450 missense probably damaging 1.00
R2224:Mgam UTSW 6 40764274 splice site probably null
R2408:Mgam UTSW 6 40686522 missense probably damaging 1.00
R2508:Mgam UTSW 6 40759783 missense probably damaging 1.00
R2842:Mgam UTSW 6 40661345 missense probably benign 0.01
R2847:Mgam UTSW 6 40652715 missense possibly damaging 0.67
R2848:Mgam UTSW 6 40652715 missense possibly damaging 0.67
R2965:Mgam UTSW 6 40768220 missense possibly damaging 0.46
R2966:Mgam UTSW 6 40768220 missense possibly damaging 0.46
R3035:Mgam UTSW 6 40663530 missense probably benign
R3895:Mgam UTSW 6 40759120 missense probably damaging 1.00
R4027:Mgam UTSW 6 40754902 missense probably damaging 1.00
R4030:Mgam UTSW 6 40754902 missense probably damaging 1.00
R4302:Mgam UTSW 6 40763085 missense probably benign 0.02
R4707:Mgam UTSW 6 40714632 splice site probably null
R4826:Mgam UTSW 6 40680648 missense possibly damaging 0.52
R4898:Mgam UTSW 6 40643054 missense probably benign
R5438:Mgam UTSW 6 40684521 missense probably damaging 1.00
R5492:Mgam UTSW 6 40756363 missense probably damaging 1.00
R5770:Mgam UTSW 6 40669804 missense probably benign 0.01
R5839:Mgam UTSW 6 40740064 missense possibly damaging 0.90
R5845:Mgam UTSW 6 40675323 missense possibly damaging 0.78
R5847:Mgam UTSW 6 40684055 missense probably benign 0.42
R5891:Mgam UTSW 6 40744348 missense probably benign
R6158:Mgam UTSW 6 40757714 missense probably damaging 1.00
R6193:Mgam UTSW 6 40747920 nonsense probably null
R6423:Mgam UTSW 6 40677045 missense possibly damaging 0.84
R6706:Mgam UTSW 6 40744786 missense probably benign 0.00
R6813:Mgam UTSW 6 40750165 missense probably damaging 0.99
R6863:Mgam UTSW 6 40729009 missense probably benign 0.00
R6906:Mgam UTSW 6 40747919 missense probably damaging 1.00
R7091:Mgam UTSW 6 40768276 missense possibly damaging 0.95
R7099:Mgam UTSW 6 40661716 missense probably benign 0.09
R7282:Mgam UTSW 6 40656512 missense possibly damaging 0.71
R7282:Mgam UTSW 6 40763111 missense probably benign
R7354:Mgam UTSW 6 40744798 missense probably damaging 1.00
R7374:Mgam UTSW 6 40757439 missense possibly damaging 0.89
R7399:Mgam UTSW 6 40666854 missense probably damaging 0.99
R7406:Mgam UTSW 6 40663525 missense probably benign 0.13
R7446:Mgam UTSW 6 40746332 missense probably damaging 1.00
R7466:Mgam UTSW 6 40744789 missense probably benign 0.00
R7525:Mgam UTSW 6 40766020 missense probably benign 0.01
R7530:Mgam UTSW 6 40709218 splice site probably null
R7570:Mgam UTSW 6 40746433 missense probably benign 0.16
R7669:Mgam UTSW 6 40659010 missense probably benign 0.00
R7679:Mgam UTSW 6 40643046 missense probably damaging 0.98
R7746:Mgam UTSW 6 40668193 missense probably damaging 0.99
R7859:Mgam UTSW 6 40740179 missense possibly damaging 0.75
R7925:Mgam UTSW 6 40759051 missense probably damaging 0.99
R8206:Mgam UTSW 6 40680235 missense probably benign 0.00
R8244:Mgam UTSW 6 40750586 missense probably damaging 1.00
R8309:Mgam UTSW 6 40745177 missense possibly damaging 0.88
RF020:Mgam UTSW 6 40685309 missense probably damaging 1.00
RF023:Mgam UTSW 6 40680708 missense probably benign
X0021:Mgam UTSW 6 40659047 missense probably damaging 1.00
Z1088:Mgam UTSW 6 40643060 missense probably benign 0.01
Z1176:Mgam UTSW 6 40677644 critical splice donor site probably null
Z1176:Mgam UTSW 6 40729066 missense probably damaging 1.00
Z1177:Mgam UTSW 6 40740071 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACAGTGCAATGGGTTTACC -3'
(R):5'- GCACAGGACATTCTCTGCAC -3'

Sequencing Primer
(F):5'- CCACATGATGAAGTTGTTAGCTGAC -3'
(R):5'- AAGGATCTTACTCCCACCCCTG -3'
Posted On2019-12-04