Incidental Mutation 'RF011:Hcn4'
ID603211
Institutional Source Beutler Lab
Gene Symbol Hcn4
Ensembl Gene ENSMUSG00000032338
Gene Namehyperpolarization-activated, cyclic nucleotide-gated K+ 4
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF011 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location58823412-58863175 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58859915 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 920 (S920T)
Ref Sequence ENSEMBL: ENSMUSP00000034889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034889]
Predicted Effect unknown
Transcript: ENSMUST00000034889
AA Change: S920T
SMART Domains Protein: ENSMUSP00000034889
Gene: ENSMUSG00000032338
AA Change: S920T

DomainStartEndE-ValueType
low complexity region 27 39 N/A INTRINSIC
low complexity region 43 59 N/A INTRINSIC
low complexity region 97 120 N/A INTRINSIC
low complexity region 150 184 N/A INTRINSIC
Pfam:Ion_trans_N 218 261 1.2e-23 PFAM
Pfam:Ion_trans 262 525 2.2e-25 PFAM
low complexity region 526 537 N/A INTRINSIC
Blast:cNMP 538 570 9e-13 BLAST
cNMP 595 708 2.27e-23 SMART
low complexity region 761 771 N/A INTRINSIC
low complexity region 775 796 N/A INTRINSIC
low complexity region 808 818 N/A INTRINSIC
low complexity region 831 856 N/A INTRINSIC
low complexity region 866 906 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 931 956 N/A INTRINSIC
low complexity region 960 987 N/A INTRINSIC
low complexity region 991 1004 N/A INTRINSIC
low complexity region 1021 1036 N/A INTRINSIC
low complexity region 1045 1073 N/A INTRINSIC
low complexity region 1123 1140 N/A INTRINSIC
low complexity region 1154 1164 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hyperpolarization-activated cyclic nucleotide-gated potassium channels. The encoded protein shows slow kinetics of activation and inactivation, and is necessary for the cardiac pacemaking process. This channel may also mediate responses to sour stimuli. Mutations in this gene have been linked to sick sinus syndrome 2, also known as atrial fibrillation with bradyarrhythmia or familial sinus bradycardia. Two pseudogenes have been identified on chromosome 15. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene experience embryonic lethality between E9.5 and E11.5. Conditional deletion in cardiac tissue results in severe bradycardia and death. Mice over-expressing the gene exhibit impaired firing rate in ORN, small olfactory bulb and reduced glomeruli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,743,609 K672R possibly damaging Het
A030005L19Rik GTGGTGGCTG GTGGTGGCTGTGGTGGCTG 1: 82,913,569 probably benign Het
A030005L19Rik TGGCTGCTG TGGCTGCTGGGGCTGCTG 1: 82,913,573 probably benign Het
A030005L19Rik TGCTG TGCTGTGGCGGCTG 1: 82,913,586 probably benign Het
AI837181 GCG GCGTCG 19: 5,425,236 probably benign Het
Ankrd24 C CGGAGGCAGAGGA 10: 81,643,571 probably benign Het
Aqp2 T C 15: 99,583,872 S216P probably damaging Het
Cacna1f GGA GGAAGA X: 7,620,056 probably benign Het
Ccdc170 CCA CCAGCA 10: 4,561,018 probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,712,528 probably benign Het
Cela2a T C 4: 141,821,715 N117D probably benign Het
Cul9 CTTC CTTCTTC 17: 46,500,848 probably benign Het
Cyb5r2 A T 7: 107,751,168 S235R probably benign Het
Dnmt1 CACAGTTCCTACCTCGTT CACAGTTCCTACCTCGTTTTGGGGGCGGAGAACAGTTCCTACCTCGTT 9: 20,910,128 probably null Het
Dnmt1 TT TTTTGGGGGCGGAGCACAGTTCCTACCTCGAT 9: 20,910,144 probably null Het
E4f1 CCG CCGTCG 17: 24,455,186 probably benign Het
Fam171b TCCAGCA TCCAGCACCAGCA 2: 83,812,873 probably benign Het
Fam171b GC GCAGCATC 2: 83,812,895 probably benign Het
Fam81b CTGTT CTGTTGTT 13: 76,271,316 probably benign Het
Fkbp1a GCCGCCGCCA G 2: 151,542,699 probably null Het
Flii G A 11: 60,716,243 A969V probably benign Het
Fscb AGTGGAACTTCTGCAGGCCCCTCTTCAGTTAGTGTAGGTGGAACTTCTGCAGGCCCCTCTTCAGTTAGTGGAGGTGGAACTTCTGCAGG AGTGGAACTTCTGCAGGCCCCTCTTCAGTTAGTGGAGGTGGAACTTCTGCAGG 12: 64,472,994 probably benign Het
Gas1 G GAAA 13: 60,176,531 probably benign Het
Grip1 A G 10: 119,931,315 D115G probably null Het
Guca2b G T 4: 119,656,847 T89N possibly damaging Het
Heatr1 A G 13: 12,407,544 M484V probably benign Het
Iba57 G T 11: 59,163,612 A27E probably benign Het
Ifi207 G C 1: 173,729,121 L684V not run Het
Ints13 T C 6: 146,556,240 H380R probably damaging Het
Jmjd1c C T 10: 67,220,199 T466I possibly damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Kif12 C CCTCCACCCGGCGGGG 4: 63,171,427 probably benign Het
Kmt2c A T 5: 25,338,459 D1399E probably damaging Het
Macf1 A T 4: 123,473,855 L2371Q probably damaging Het
Mbd1 GTCTTCGTCTGCATCTGCATCTGCATCT GTCT 18: 74,273,610 probably benign Het
Med12l GCA GCATCA 3: 59,275,980 probably benign Het
Mgam C A 6: 40,757,436 Q1472K probably damaging Het
Mup21 TATACTT TATACTTTTTAGATACTT 4: 62,149,345 probably benign Het
Nipal1 A G 5: 72,666,813 N167D probably damaging Het
Olfr1105 T A 2: 87,034,041 Y60F probably damaging Het
Olfr1426 C T 19: 12,088,247 V182I probably benign Het
Osbpl3 CCTGCA C 6: 50,348,138 probably benign Het
Phf20 CCCCCCCCC CCCCCCCCCCCCCCCC 2: 156,304,620 probably benign Het
Phf20 CCCCCCCC CCCCCCCCCCCCCCC 2: 156,304,621 probably benign Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Rassf6 TCCTGTAGAGCAATGGGGATTC TCCTGTAGAGCAATGGGGATTCTGCCTCACTCATGGGCCTGTAGAGCAATGGGGATTC 5: 90,608,921 probably benign Het
Rbm33 CCAGCCGCAGC CCAGC 5: 28,394,181 probably benign Het
Rubcnl T C 14: 75,044,438 F445S probably damaging Het
S100a10 TTTTTTTA T 3: 93,564,234 probably benign Het
Sbp AA AAAATGCTGACAACGGA 17: 23,945,354 probably benign Het
Sec14l3 A C 11: 4,067,963 Q81P possibly damaging Het
Setd1a TGGTGGTGG TGGTGGTGGGGGTGGTGG 7: 127,785,343 probably benign Het
Six3 CGG CGGGGG 17: 85,621,368 probably benign Het
Snapc5 ATGGAAGAAGAGG A 9: 64,182,211 probably benign Het
Tbc1d12 CGGAGGAGG CGG 19: 38,836,957 probably benign Het
Tcof1 AGC AGCCGC 18: 60,835,739 probably benign Het
Tmem28 CGCCGC CGCCGCAGCCGC X: 99,821,361 probably benign Het
Tox2 A G 2: 163,225,564 I68V probably benign Het
Triml2 G T 8: 43,183,164 probably benign Het
Tspan33 A G 6: 29,716,730 Y162C probably damaging Het
Zfp384 GGCCCAGGCCCA GGCCCAGGCCCAAGCCCAGGCCCA 6: 125,036,476 probably benign Het
Zfp948 T C 17: 21,588,312 Y589H probably damaging Het
Zic1 T C 9: 91,364,330 I230V probably benign Het
Other mutations in Hcn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Hcn4 APN 9 58860053 missense unknown
IGL00939:Hcn4 APN 9 58843927 missense probably benign 0.39
IGL01154:Hcn4 APN 9 58859079 missense unknown
IGL01408:Hcn4 APN 9 58859886 missense unknown
IGL02658:Hcn4 APN 9 58859465 missense unknown
IGL02877:Hcn4 APN 9 58859167 missense unknown
IGL03211:Hcn4 APN 9 58858151 missense unknown
PIT1430001:Hcn4 UTSW 9 58859550 missense unknown
R0049:Hcn4 UTSW 9 58860299 missense probably damaging 0.98
R0268:Hcn4 UTSW 9 58860162 missense unknown
R0812:Hcn4 UTSW 9 58823512 start codon destroyed probably null
R2121:Hcn4 UTSW 9 58824058 missense unknown
R3035:Hcn4 UTSW 9 58823680 missense unknown
R3715:Hcn4 UTSW 9 58844036 missense unknown
R3737:Hcn4 UTSW 9 58843889 missense probably benign 0.39
R3958:Hcn4 UTSW 9 58844048 missense unknown
R4035:Hcn4 UTSW 9 58843889 missense probably benign 0.39
R4393:Hcn4 UTSW 9 58844300 missense unknown
R4418:Hcn4 UTSW 9 58843895 missense probably benign 0.39
R4532:Hcn4 UTSW 9 58857798 missense unknown
R4765:Hcn4 UTSW 9 58857977 missense unknown
R4857:Hcn4 UTSW 9 58859570 missense unknown
R4967:Hcn4 UTSW 9 58859828 missense unknown
R5068:Hcn4 UTSW 9 58860021 missense unknown
R5253:Hcn4 UTSW 9 58824275 missense unknown
R5304:Hcn4 UTSW 9 58843932 missense probably benign 0.39
R5600:Hcn4 UTSW 9 58859293 splice site probably null
R6346:Hcn4 UTSW 9 58859044 missense unknown
R6575:Hcn4 UTSW 9 58824152 missense unknown
R6622:Hcn4 UTSW 9 58857727 missense unknown
R6967:Hcn4 UTSW 9 58823945 missense unknown
R7038:Hcn4 UTSW 9 58823584 missense unknown
R7054:Hcn4 UTSW 9 58855717 missense unknown
R7229:Hcn4 UTSW 9 58853399 missense unknown
R7407:Hcn4 UTSW 9 58859370 missense unknown
R7448:Hcn4 UTSW 9 58844299 missense unknown
R7531:Hcn4 UTSW 9 58860137 missense unknown
R7572:Hcn4 UTSW 9 58823780 missense unknown
R7680:Hcn4 UTSW 9 58860671 missense probably benign 0.08
R7915:Hcn4 UTSW 9 58823935 missense unknown
R7956:Hcn4 UTSW 9 58844173 missense unknown
R8146:Hcn4 UTSW 9 58823744 missense unknown
R8234:Hcn4 UTSW 9 58844150 missense unknown
R8421:Hcn4 UTSW 9 58858096 missense unknown
X0009:Hcn4 UTSW 9 58860759 nonsense probably null
X0057:Hcn4 UTSW 9 58859368 missense unknown
Z1176:Hcn4 UTSW 9 58858148 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGACACACCGTCTTCATCC -3'
(R):5'- TAGGGACAACTCTCCAGGAG -3'

Sequencing Primer
(F):5'- ACATCCAACAGCTGGCTGG -3'
(R):5'- ACAACTCTCCAGGAGGCTGG -3'
Posted On2019-12-04