Incidental Mutation 'RF011:Zic1'
ID603214
Institutional Source Beutler Lab
Gene Symbol Zic1
Ensembl Gene ENSMUSG00000032368
Gene Namezinc finger protein of the cerebellum 1
Synonymsodd-paired homolog
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #RF011 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location91358058-91365810 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91364330 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 230 (I230V)
Ref Sequence ENSEMBL: ENSMUSP00000034927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034927] [ENSMUST00000065360] [ENSMUST00000172646] [ENSMUST00000173054] [ENSMUST00000173342]
Predicted Effect probably benign
Transcript: ENSMUST00000034927
AA Change: I230V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034927
Gene: ENSMUSG00000032368
AA Change: I230V

DomainStartEndE-ValueType
low complexity region 68 85 N/A INTRINSIC
low complexity region 110 134 N/A INTRINSIC
ZnF_C2H2 238 260 6.82e1 SMART
ZnF_C2H2 269 296 7.49e0 SMART
ZnF_C2H2 302 326 8.02e-5 SMART
ZnF_C2H2 332 356 1.58e-3 SMART
ZnF_C2H2 362 384 4.54e-4 SMART
low complexity region 386 400 N/A INTRINSIC
low complexity region 403 427 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065360
AA Change: I230V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000068858
Gene: ENSMUSG00000032368
AA Change: I230V

DomainStartEndE-ValueType
low complexity region 68 85 N/A INTRINSIC
low complexity region 110 134 N/A INTRINSIC
ZnF_C2H2 238 260 6.82e1 SMART
ZnF_C2H2 269 296 7.49e0 SMART
ZnF_C2H2 302 326 8.02e-5 SMART
ZnF_C2H2 332 356 1.58e-3 SMART
ZnF_C2H2 362 384 4.54e-4 SMART
low complexity region 386 400 N/A INTRINSIC
low complexity region 403 427 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172646
SMART Domains Protein: ENSMUSP00000134053
Gene: ENSMUSG00000036972

DomainStartEndE-ValueType
ZnF_C2H2 128 162 4.74e1 SMART
ZnF_C2H2 171 198 7.68e0 SMART
ZnF_C2H2 204 228 8.02e-5 SMART
ZnF_C2H2 234 258 7.15e-2 SMART
ZnF_C2H2 264 288 3.21e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173054
SMART Domains Protein: ENSMUSP00000134364
Gene: ENSMUSG00000036972

DomainStartEndE-ValueType
PDB:2EJ4|A 122 181 3e-16 PDB
Blast:ZnF_C2H2 128 151 5e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173342
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. Members of this family are important during development. Aberrant expression of this gene is seen in medulloblastoma, a childhood brain tumor. This gene is closely linked to the gene encoding zinc finger protein of the cerebellum 4, a related family member on chromosome 3. This gene encodes a transcription factor that can bind and transactivate the apolipoprotein E gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show cerebellar hypoplasia with a missing lobule of the anterior lobe. Newborn pups suckle poorly. 50% die within one day of birth and almost all die within 3 weeks; longer survivors show marked ataxia and exhibit tonic convulsions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,743,609 K672R possibly damaging Het
A030005L19Rik GTGGTGGCTG GTGGTGGCTGTGGTGGCTG 1: 82,913,569 probably benign Het
A030005L19Rik TGGCTGCTG TGGCTGCTGGGGCTGCTG 1: 82,913,573 probably benign Het
A030005L19Rik TGCTG TGCTGTGGCGGCTG 1: 82,913,586 probably benign Het
AI837181 GCG GCGTCG 19: 5,425,236 probably benign Het
Ankrd24 C CGGAGGCAGAGGA 10: 81,643,571 probably benign Het
Aqp2 T C 15: 99,583,872 S216P probably damaging Het
Cacna1f GGA GGAAGA X: 7,620,056 probably benign Het
Ccdc170 CCA CCAGCA 10: 4,561,018 probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,712,528 probably benign Het
Cela2a T C 4: 141,821,715 N117D probably benign Het
Cul9 CTTC CTTCTTC 17: 46,500,848 probably benign Het
Cyb5r2 A T 7: 107,751,168 S235R probably benign Het
Dnmt1 CACAGTTCCTACCTCGTT CACAGTTCCTACCTCGTTTTGGGGGCGGAGAACAGTTCCTACCTCGTT 9: 20,910,128 probably null Het
Dnmt1 TT TTTTGGGGGCGGAGCACAGTTCCTACCTCGAT 9: 20,910,144 probably null Het
E4f1 CCG CCGTCG 17: 24,455,186 probably benign Het
Fam171b TCCAGCA TCCAGCACCAGCA 2: 83,812,873 probably benign Het
Fam171b GC GCAGCATC 2: 83,812,895 probably benign Het
Fam81b CTGTT CTGTTGTT 13: 76,271,316 probably benign Het
Fkbp1a GCCGCCGCCA G 2: 151,542,699 probably null Het
Flii G A 11: 60,716,243 A969V probably benign Het
Fscb AGTGGAACTTCTGCAGGCCCCTCTTCAGTTAGTGTAGGTGGAACTTCTGCAGGCCCCTCTTCAGTTAGTGGAGGTGGAACTTCTGCAGG AGTGGAACTTCTGCAGGCCCCTCTTCAGTTAGTGGAGGTGGAACTTCTGCAGG 12: 64,472,994 probably benign Het
Gas1 G GAAA 13: 60,176,531 probably benign Het
Grip1 A G 10: 119,931,315 D115G probably null Het
Guca2b G T 4: 119,656,847 T89N possibly damaging Het
Hcn4 T A 9: 58,859,915 S920T unknown Het
Heatr1 A G 13: 12,407,544 M484V probably benign Het
Iba57 G T 11: 59,163,612 A27E probably benign Het
Ifi207 G C 1: 173,729,121 L684V not run Het
Ints13 T C 6: 146,556,240 H380R probably damaging Het
Jmjd1c C T 10: 67,220,199 T466I possibly damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Kif12 C CCTCCACCCGGCGGGG 4: 63,171,427 probably benign Het
Kmt2c A T 5: 25,338,459 D1399E probably damaging Het
Macf1 A T 4: 123,473,855 L2371Q probably damaging Het
Mbd1 GTCTTCGTCTGCATCTGCATCTGCATCT GTCT 18: 74,273,610 probably benign Het
Med12l GCA GCATCA 3: 59,275,980 probably benign Het
Mgam C A 6: 40,757,436 Q1472K probably damaging Het
Mup21 TATACTT TATACTTTTTAGATACTT 4: 62,149,345 probably benign Het
Nipal1 A G 5: 72,666,813 N167D probably damaging Het
Olfr1105 T A 2: 87,034,041 Y60F probably damaging Het
Olfr1426 C T 19: 12,088,247 V182I probably benign Het
Osbpl3 CCTGCA C 6: 50,348,138 probably benign Het
Phf20 CCCCCCCCC CCCCCCCCCCCCCCCC 2: 156,304,620 probably benign Het
Phf20 CCCCCCCC CCCCCCCCCCCCCCC 2: 156,304,621 probably benign Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Rassf6 TCCTGTAGAGCAATGGGGATTC TCCTGTAGAGCAATGGGGATTCTGCCTCACTCATGGGCCTGTAGAGCAATGGGGATTC 5: 90,608,921 probably benign Het
Rbm33 CCAGCCGCAGC CCAGC 5: 28,394,181 probably benign Het
Rubcnl T C 14: 75,044,438 F445S probably damaging Het
S100a10 TTTTTTTA T 3: 93,564,234 probably benign Het
Sbp AA AAAATGCTGACAACGGA 17: 23,945,354 probably benign Het
Sec14l3 A C 11: 4,067,963 Q81P possibly damaging Het
Setd1a TGGTGGTGG TGGTGGTGGGGGTGGTGG 7: 127,785,343 probably benign Het
Six3 CGG CGGGGG 17: 85,621,368 probably benign Het
Snapc5 ATGGAAGAAGAGG A 9: 64,182,211 probably benign Het
Tbc1d12 CGGAGGAGG CGG 19: 38,836,957 probably benign Het
Tcof1 AGC AGCCGC 18: 60,835,739 probably benign Het
Tmem28 CGCCGC CGCCGCAGCCGC X: 99,821,361 probably benign Het
Tox2 A G 2: 163,225,564 I68V probably benign Het
Triml2 G T 8: 43,183,164 probably benign Het
Tspan33 A G 6: 29,716,730 Y162C probably damaging Het
Zfp384 GGCCCAGGCCCA GGCCCAGGCCCAAGCCCAGGCCCA 6: 125,036,476 probably benign Het
Zfp948 T C 17: 21,588,312 Y589H probably damaging Het
Other mutations in Zic1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02022:Zic1 APN 9 91362472 splice site probably null
IGL02669:Zic1 APN 9 91364433 missense possibly damaging 0.71
IGL02968:Zic1 APN 9 91362490 missense probably damaging 1.00
PIT4812001:Zic1 UTSW 9 91364341 missense probably damaging 1.00
R1493:Zic1 UTSW 9 91364756 missense probably damaging 1.00
R1599:Zic1 UTSW 9 91361688 missense probably benign 0.08
R1742:Zic1 UTSW 9 91361576 missense probably damaging 0.98
R2158:Zic1 UTSW 9 91364893 missense possibly damaging 0.73
R4587:Zic1 UTSW 9 91364822 missense probably damaging 1.00
R4735:Zic1 UTSW 9 91364505 missense possibly damaging 0.55
R4830:Zic1 UTSW 9 91362531 missense probably damaging 1.00
R5186:Zic1 UTSW 9 91364371 missense probably damaging 1.00
R5702:Zic1 UTSW 9 91364080 missense probably damaging 0.99
R6298:Zic1 UTSW 9 91364503 missense probably damaging 1.00
R7221:Zic1 UTSW 9 91364732 missense probably damaging 1.00
R7250:Zic1 UTSW 9 91364975 missense probably damaging 0.99
R7764:Zic1 UTSW 9 91365692 intron probably benign
R7806:Zic1 UTSW 9 91364971 missense probably damaging 1.00
R7951:Zic1 UTSW 9 91362601 missense probably damaging 0.99
R8408:Zic1 UTSW 9 91364794 missense probably damaging 0.97
Z1177:Zic1 UTSW 9 91364579 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCTGAACGCGCGAAAAC -3'
(R):5'- GTTTCTCCGGGGACATGTAC -3'

Sequencing Primer
(F):5'- CACTCGGATGTGGTTGACC -3'
(R):5'- ATGTACCCACGGCCGGAAC -3'
Posted On2019-12-04