Incidental Mutation 'RF011:Ankrd24'
Institutional Source Beutler Lab
Gene Symbol Ankrd24
Ensembl Gene ENSMUSG00000054708
Gene Nameankyrin repeat domain 24
Synonyms4631433D01Rik, 5730519E19Rik, D10Bur2e
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.568) question?
Stock #RF011 (G1)
Quality Score214.458
Status Not validated
Chromosomal Location81628540-81647610 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to CGGAGGCAGAGGA at 81643571 bp
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000119336] [ENSMUST00000123993] [ENSMUST00000126323]
Predicted Effect probably benign
Transcript: ENSMUST00000119336
SMART Domains Protein: ENSMUSP00000112932
Gene: ENSMUSG00000054708

Blast:ANK 18 48 1e-6 BLAST
ANK 52 81 2.92e-2 SMART
ANK 85 114 7.53e-5 SMART
ANK 118 149 4.07e-1 SMART
ANK 151 180 2.92e-2 SMART
ANK 184 213 3.97e-4 SMART
low complexity region 240 250 N/A INTRINSIC
low complexity region 269 283 N/A INTRINSIC
internal_repeat_2 488 606 4.87e-8 PROSPERO
internal_repeat_2 597 713 4.87e-8 PROSPERO
low complexity region 718 736 N/A INTRINSIC
coiled coil region 747 895 N/A INTRINSIC
Blast:ANK 950 977 3e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123305
Predicted Effect probably benign
Transcript: ENSMUST00000123993
SMART Domains Protein: ENSMUSP00000117975
Gene: ENSMUSG00000054708

signal peptide 1 21 N/A INTRINSIC
Blast:ANK 48 78 2e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000126323
SMART Domains Protein: ENSMUSP00000118286
Gene: ENSMUSG00000054708

ANK 7 36 2.92e-2 SMART
ANK 40 69 3.97e-4 SMART
low complexity region 96 106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132458
SMART Domains Protein: ENSMUSP00000121709
Gene: ENSMUSG00000054708

coiled coil region 1 94 N/A INTRINSIC
Blast:ANK 142 175 3e-7 BLAST
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,743,609 K672R possibly damaging Het
A030005L19Rik GTGGTGGCTG GTGGTGGCTGTGGTGGCTG 1: 82,913,569 probably benign Het
A030005L19Rik TGGCTGCTG TGGCTGCTGGGGCTGCTG 1: 82,913,573 probably benign Het
A030005L19Rik TGCTG TGCTGTGGCGGCTG 1: 82,913,586 probably benign Het
AI837181 GCG GCGTCG 19: 5,425,236 probably benign Het
Aqp2 T C 15: 99,583,872 S216P probably damaging Het
Cacna1f GGA GGAAGA X: 7,620,056 probably benign Het
Ccdc170 CCA CCAGCA 10: 4,561,018 probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,712,528 probably benign Het
Cela2a T C 4: 141,821,715 N117D probably benign Het
Cul9 CTTC CTTCTTC 17: 46,500,848 probably benign Het
Cyb5r2 A T 7: 107,751,168 S235R probably benign Het
Dnmt1 TT TTTTGGGGGCGGAGCACAGTTCCTACCTCGAT 9: 20,910,144 probably null Het
E4f1 CCG CCGTCG 17: 24,455,186 probably benign Het
Fam171b TCCAGCA TCCAGCACCAGCA 2: 83,812,873 probably benign Het
Fam171b GC GCAGCATC 2: 83,812,895 probably benign Het
Fam81b CTGTT CTGTTGTT 13: 76,271,316 probably benign Het
Fkbp1a GCCGCCGCCA G 2: 151,542,699 probably null Het
Flii G A 11: 60,716,243 A969V probably benign Het
Gas1 G GAAA 13: 60,176,531 probably benign Het
Grip1 A G 10: 119,931,315 D115G probably null Het
Guca2b G T 4: 119,656,847 T89N possibly damaging Het
Hcn4 T A 9: 58,859,915 S920T unknown Het
Heatr1 A G 13: 12,407,544 M484V probably benign Het
Iba57 G T 11: 59,163,612 A27E probably benign Het
Ifi207 G C 1: 173,729,121 L684V not run Het
Ints13 T C 6: 146,556,240 H380R probably damaging Het
Jmjd1c C T 10: 67,220,199 T466I possibly damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Kif12 C CCTCCACCCGGCGGGG 4: 63,171,427 probably benign Het
Kmt2c A T 5: 25,338,459 D1399E probably damaging Het
Macf1 A T 4: 123,473,855 L2371Q probably damaging Het
Mbd1 GTCTTCGTCTGCATCTGCATCTGCATCT GTCT 18: 74,273,610 probably benign Het
Med12l GCA GCATCA 3: 59,275,980 probably benign Het
Mgam C A 6: 40,757,436 Q1472K probably damaging Het
Mup21 TATACTT TATACTTTTTAGATACTT 4: 62,149,345 probably benign Het
Nipal1 A G 5: 72,666,813 N167D probably damaging Het
Olfr1105 T A 2: 87,034,041 Y60F probably damaging Het
Olfr1426 C T 19: 12,088,247 V182I probably benign Het
Osbpl3 CCTGCA C 6: 50,348,138 probably benign Het
Phf20 CCCCCCCCC CCCCCCCCCCCCCCCC 2: 156,304,620 probably benign Het
Phf20 CCCCCCCC CCCCCCCCCCCCCCC 2: 156,304,621 probably benign Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Rbm33 CCAGCCGCAGC CCAGC 5: 28,394,181 probably benign Het
Rubcnl T C 14: 75,044,438 F445S probably damaging Het
S100a10 TTTTTTTA T 3: 93,564,234 probably benign Het
Sbp AA AAAATGCTGACAACGGA 17: 23,945,354 probably benign Het
Sec14l3 A C 11: 4,067,963 Q81P possibly damaging Het
Setd1a TGGTGGTGG TGGTGGTGGGGGTGGTGG 7: 127,785,343 probably benign Het
Six3 CGG CGGGGG 17: 85,621,368 probably benign Het
Snapc5 ATGGAAGAAGAGG A 9: 64,182,211 probably benign Het
Tbc1d12 CGGAGGAGG CGG 19: 38,836,957 probably benign Het
Tcof1 AGC AGCCGC 18: 60,835,739 probably benign Het
Tmem28 CGCCGC CGCCGCAGCCGC X: 99,821,361 probably benign Het
Tox2 A G 2: 163,225,564 I68V probably benign Het
Triml2 G T 8: 43,183,164 probably benign Het
Tspan33 A G 6: 29,716,730 Y162C probably damaging Het
Zfp384 GGCCCAGGCCCA GGCCCAGGCCCAAGCCCAGGCCCA 6: 125,036,476 probably benign Het
Zfp948 T C 17: 21,588,312 Y589H probably damaging Het
Zic1 T C 9: 91,364,330 I230V probably benign Het
Other mutations in Ankrd24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:Ankrd24 APN 10 81643145 unclassified probably benign
IGL00809:Ankrd24 APN 10 81643067 unclassified probably benign
IGL01021:Ankrd24 APN 10 81635161 splice site probably null
IGL01073:Ankrd24 APN 10 81639322 missense possibly damaging 0.76
IGL01875:Ankrd24 APN 10 81629737 unclassified probably benign
IGL03083:Ankrd24 APN 10 81638649 missense probably benign
IGL03335:Ankrd24 APN 10 81647133 missense probably benign 0.18
R0129:Ankrd24 UTSW 10 81638329 missense probably damaging 1.00
R0243:Ankrd24 UTSW 10 81634944 missense probably damaging 1.00
R0522:Ankrd24 UTSW 10 81636355 splice site probably benign
R0607:Ankrd24 UTSW 10 81638308 missense probably damaging 0.98
R0707:Ankrd24 UTSW 10 81642713 unclassified probably benign
R1472:Ankrd24 UTSW 10 81634920 missense probably damaging 1.00
R1766:Ankrd24 UTSW 10 81638638 missense probably benign 0.13
R1852:Ankrd24 UTSW 10 81642941 unclassified probably benign
R1891:Ankrd24 UTSW 10 81643508 unclassified probably benign
R2137:Ankrd24 UTSW 10 81646309 missense probably damaging 1.00
R3790:Ankrd24 UTSW 10 81642679 unclassified probably benign
R4798:Ankrd24 UTSW 10 81643315 unclassified probably benign
R4952:Ankrd24 UTSW 10 81647148 missense probably benign 0.01
R5068:Ankrd24 UTSW 10 81639865 missense possibly damaging 0.87
R5237:Ankrd24 UTSW 10 81642545 unclassified probably benign
R5418:Ankrd24 UTSW 10 81644942 unclassified probably benign
R5795:Ankrd24 UTSW 10 81645103 unclassified probably benign
R7188:Ankrd24 UTSW 10 81636390 nonsense probably null
R7614:Ankrd24 UTSW 10 81638689 missense unknown
R7750:Ankrd24 UTSW 10 81646794 missense possibly damaging 0.72
R8004:Ankrd24 UTSW 10 81638357 missense unknown
R8190:Ankrd24 UTSW 10 81638318 missense unknown
R8415:Ankrd24 UTSW 10 81640113 missense unknown
RF001:Ankrd24 UTSW 10 81643571 unclassified probably benign
RF037:Ankrd24 UTSW 10 81643573 nonsense probably null
RF061:Ankrd24 UTSW 10 81643567 nonsense probably null
Z1088:Ankrd24 UTSW 10 81638656 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04