Incidental Mutation 'RF011:Zfp948'
Institutional Source Beutler Lab
Gene Symbol Zfp948
Ensembl Gene ENSMUSG00000067931
Gene Namezinc finger protein 948
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #RF011 (G1)
Quality Score225.009
Status Not validated
Chromosomal Location21567046-21588697 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21588312 bp
Amino Acid Change Tyrosine to Histidine at position 589 (Y589H)
Ref Sequence ENSEMBL: ENSMUSP00000086166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088787]
Predicted Effect probably damaging
Transcript: ENSMUST00000088787
AA Change: Y589H

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000086166
Gene: ENSMUSG00000067931
AA Change: Y589H

KRAB 13 72 1.04e-21 SMART
low complexity region 164 173 N/A INTRINSIC
ZnF_C2H2 214 236 3.16e-3 SMART
ZnF_C2H2 242 264 9.58e-3 SMART
ZnF_C2H2 270 292 2.84e-5 SMART
ZnF_C2H2 298 320 8.22e-2 SMART
ZnF_C2H2 353 375 1.69e-3 SMART
ZnF_C2H2 381 403 9.88e-5 SMART
ZnF_C2H2 409 431 9.08e-4 SMART
ZnF_C2H2 437 459 2.2e-2 SMART
ZnF_C2H2 465 487 5.99e-4 SMART
ZnF_C2H2 493 515 8.47e-4 SMART
ZnF_C2H2 521 543 5.21e-4 SMART
ZnF_C2H2 549 571 9.73e-4 SMART
ZnF_C2H2 577 599 2.43e-4 SMART
ZnF_C2H2 605 627 2.91e-2 SMART
ZnF_C2H2 633 655 4.72e-2 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,743,609 K672R possibly damaging Het
A030005L19Rik GTGGTGGCTG GTGGTGGCTGTGGTGGCTG 1: 82,913,569 probably benign Het
A030005L19Rik TGGCTGCTG TGGCTGCTGGGGCTGCTG 1: 82,913,573 probably benign Het
A030005L19Rik TGCTG TGCTGTGGCGGCTG 1: 82,913,586 probably benign Het
AI837181 GCG GCGTCG 19: 5,425,236 probably benign Het
Ankrd24 C CGGAGGCAGAGGA 10: 81,643,571 probably benign Het
Aqp2 T C 15: 99,583,872 S216P probably damaging Het
Cacna1f GGA GGAAGA X: 7,620,056 probably benign Het
Ccdc170 CCA CCAGCA 10: 4,561,018 probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,712,528 probably benign Het
Cela2a T C 4: 141,821,715 N117D probably benign Het
Cul9 CTTC CTTCTTC 17: 46,500,848 probably benign Het
Cyb5r2 A T 7: 107,751,168 S235R probably benign Het
Dnmt1 TT TTTTGGGGGCGGAGCACAGTTCCTACCTCGAT 9: 20,910,144 probably null Het
E4f1 CCG CCGTCG 17: 24,455,186 probably benign Het
Fam171b TCCAGCA TCCAGCACCAGCA 2: 83,812,873 probably benign Het
Fam171b GC GCAGCATC 2: 83,812,895 probably benign Het
Fam81b CTGTT CTGTTGTT 13: 76,271,316 probably benign Het
Fkbp1a GCCGCCGCCA G 2: 151,542,699 probably null Het
Flii G A 11: 60,716,243 A969V probably benign Het
Gas1 G GAAA 13: 60,176,531 probably benign Het
Grip1 A G 10: 119,931,315 D115G probably null Het
Guca2b G T 4: 119,656,847 T89N possibly damaging Het
Hcn4 T A 9: 58,859,915 S920T unknown Het
Heatr1 A G 13: 12,407,544 M484V probably benign Het
Iba57 G T 11: 59,163,612 A27E probably benign Het
Ifi207 G C 1: 173,729,121 L684V not run Het
Ints13 T C 6: 146,556,240 H380R probably damaging Het
Jmjd1c C T 10: 67,220,199 T466I possibly damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Kif12 C CCTCCACCCGGCGGGG 4: 63,171,427 probably benign Het
Kmt2c A T 5: 25,338,459 D1399E probably damaging Het
Macf1 A T 4: 123,473,855 L2371Q probably damaging Het
Mbd1 GTCTTCGTCTGCATCTGCATCTGCATCT GTCT 18: 74,273,610 probably benign Het
Med12l GCA GCATCA 3: 59,275,980 probably benign Het
Mgam C A 6: 40,757,436 Q1472K probably damaging Het
Mup21 TATACTT TATACTTTTTAGATACTT 4: 62,149,345 probably benign Het
Nipal1 A G 5: 72,666,813 N167D probably damaging Het
Olfr1105 T A 2: 87,034,041 Y60F probably damaging Het
Olfr1426 C T 19: 12,088,247 V182I probably benign Het
Osbpl3 CCTGCA C 6: 50,348,138 probably benign Het
Phf20 CCCCCCCCC CCCCCCCCCCCCCCCC 2: 156,304,620 probably benign Het
Phf20 CCCCCCCC CCCCCCCCCCCCCCC 2: 156,304,621 probably benign Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Rbm33 CCAGCCGCAGC CCAGC 5: 28,394,181 probably benign Het
Rubcnl T C 14: 75,044,438 F445S probably damaging Het
S100a10 TTTTTTTA T 3: 93,564,234 probably benign Het
Sbp AA AAAATGCTGACAACGGA 17: 23,945,354 probably benign Het
Sec14l3 A C 11: 4,067,963 Q81P possibly damaging Het
Setd1a TGGTGGTGG TGGTGGTGGGGGTGGTGG 7: 127,785,343 probably benign Het
Six3 CGG CGGGGG 17: 85,621,368 probably benign Het
Snapc5 ATGGAAGAAGAGG A 9: 64,182,211 probably benign Het
Tbc1d12 CGGAGGAGG CGG 19: 38,836,957 probably benign Het
Tcof1 AGC AGCCGC 18: 60,835,739 probably benign Het
Tmem28 CGCCGC CGCCGCAGCCGC X: 99,821,361 probably benign Het
Tox2 A G 2: 163,225,564 I68V probably benign Het
Triml2 G T 8: 43,183,164 probably benign Het
Tspan33 A G 6: 29,716,730 Y162C probably damaging Het
Zfp384 GGCCCAGGCCCA GGCCCAGGCCCAAGCCCAGGCCCA 6: 125,036,476 probably benign Het
Zic1 T C 9: 91,364,330 I230V probably benign Het
Other mutations in Zfp948
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01787:Zfp948 APN 17 21587071 missense probably benign 0.01
R0212:Zfp948 UTSW 17 21588160 missense probably benign 0.01
R0225:Zfp948 UTSW 17 21587294 missense probably damaging 1.00
R0433:Zfp948 UTSW 17 21587502 missense probably benign 0.02
R0437:Zfp948 UTSW 17 21586998 missense unknown
R0490:Zfp948 UTSW 17 21588034 missense probably benign 0.02
R1245:Zfp948 UTSW 17 21586842 missense probably damaging 1.00
R1818:Zfp948 UTSW 17 21584807 missense probably damaging 1.00
R2106:Zfp948 UTSW 17 21587691 nonsense probably null
R3692:Zfp948 UTSW 17 21587576 missense probably benign 0.01
R4767:Zfp948 UTSW 17 21588307 missense possibly damaging 0.61
R5226:Zfp948 UTSW 17 21588243 missense probably benign 0.00
R5753:Zfp948 UTSW 17 21586894 missense probably damaging 0.97
R5766:Zfp948 UTSW 17 21584816 missense probably benign 0.02
R5959:Zfp948 UTSW 17 21587514 missense probably benign 0.01
R6167:Zfp948 UTSW 17 21587649 missense probably benign 0.38
R6291:Zfp948 UTSW 17 21587024 missense unknown
R6312:Zfp948 UTSW 17 21587167 missense possibly damaging 0.56
R6482:Zfp948 UTSW 17 21587551 missense probably benign 0.01
R7046:Zfp948 UTSW 17 21588457 missense possibly damaging 0.80
R7053:Zfp948 UTSW 17 21584859 nonsense probably null
R7207:Zfp948 UTSW 17 21588340 missense possibly damaging 0.52
R7222:Zfp948 UTSW 17 21587840 missense probably damaging 1.00
R7460:Zfp948 UTSW 17 21588415 missense probably damaging 1.00
R7760:Zfp948 UTSW 17 21588366 missense probably damaging 1.00
R7818:Zfp948 UTSW 17 21587723 missense probably benign 0.14
X0023:Zfp948 UTSW 17 21586860 missense probably benign 0.01
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04