Incidental Mutation 'RF011:Kcnh8'
Institutional Source Beutler Lab
Gene Symbol Kcnh8
Ensembl Gene ENSMUSG00000035580
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 8
SynonymsELK1, C130090D05Rik, Kv12.1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF011 (G1)
Quality Score225.009
Status Not validated
Chromosomal Location52602709-52979194 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 52978239 bp
Amino Acid Change Arginine to Histidine at position 1079 (R1079H)
Ref Sequence ENSEMBL: ENSMUSP00000049206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039366]
Predicted Effect probably benign
Transcript: ENSMUST00000039366
AA Change: R1079H

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000049206
Gene: ENSMUSG00000035580
AA Change: R1079H

Blast:PAS 16 88 9e-35 BLAST
PAC 94 136 3.42e-9 SMART
Pfam:Ion_trans 221 481 4.9e-36 PFAM
Pfam:Ion_trans_2 411 475 1.1e-12 PFAM
cNMP 551 666 1.17e-16 SMART
low complexity region 710 722 N/A INTRINSIC
coiled coil region 853 897 N/A INTRINSIC
low complexity region 1020 1036 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,743,609 K672R possibly damaging Het
A030005L19Rik GTGGTGGCTG GTGGTGGCTGTGGTGGCTG 1: 82,913,569 probably benign Het
A030005L19Rik TGGCTGCTG TGGCTGCTGGGGCTGCTG 1: 82,913,573 probably benign Het
A030005L19Rik TGCTG TGCTGTGGCGGCTG 1: 82,913,586 probably benign Het
AI837181 GCG GCGTCG 19: 5,425,236 probably benign Het
Ankrd24 C CGGAGGCAGAGGA 10: 81,643,571 probably benign Het
Aqp2 T C 15: 99,583,872 S216P probably damaging Het
Cacna1f GGA GGAAGA X: 7,620,056 probably benign Het
Ccdc170 CCA CCAGCA 10: 4,561,018 probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,712,528 probably benign Het
Cela2a T C 4: 141,821,715 N117D probably benign Het
Cul9 CTTC CTTCTTC 17: 46,500,848 probably benign Het
Cyb5r2 A T 7: 107,751,168 S235R probably benign Het
Dnmt1 TT TTTTGGGGGCGGAGCACAGTTCCTACCTCGAT 9: 20,910,144 probably null Het
E4f1 CCG CCGTCG 17: 24,455,186 probably benign Het
Fam171b TCCAGCA TCCAGCACCAGCA 2: 83,812,873 probably benign Het
Fam171b GC GCAGCATC 2: 83,812,895 probably benign Het
Fam81b CTGTT CTGTTGTT 13: 76,271,316 probably benign Het
Fkbp1a GCCGCCGCCA G 2: 151,542,699 probably null Het
Flii G A 11: 60,716,243 A969V probably benign Het
Gas1 G GAAA 13: 60,176,531 probably benign Het
Grip1 A G 10: 119,931,315 D115G probably null Het
Guca2b G T 4: 119,656,847 T89N possibly damaging Het
Hcn4 T A 9: 58,859,915 S920T unknown Het
Heatr1 A G 13: 12,407,544 M484V probably benign Het
Iba57 G T 11: 59,163,612 A27E probably benign Het
Ifi207 G C 1: 173,729,121 L684V not run Het
Ints13 T C 6: 146,556,240 H380R probably damaging Het
Jmjd1c C T 10: 67,220,199 T466I possibly damaging Het
Kif12 C CCTCCACCCGGCGGGG 4: 63,171,427 probably benign Het
Kmt2c A T 5: 25,338,459 D1399E probably damaging Het
Macf1 A T 4: 123,473,855 L2371Q probably damaging Het
Mbd1 GTCTTCGTCTGCATCTGCATCTGCATCT GTCT 18: 74,273,610 probably benign Het
Med12l GCA GCATCA 3: 59,275,980 probably benign Het
Mgam C A 6: 40,757,436 Q1472K probably damaging Het
Mup21 TATACTT TATACTTTTTAGATACTT 4: 62,149,345 probably benign Het
Nipal1 A G 5: 72,666,813 N167D probably damaging Het
Olfr1105 T A 2: 87,034,041 Y60F probably damaging Het
Olfr1426 C T 19: 12,088,247 V182I probably benign Het
Osbpl3 CCTGCA C 6: 50,348,138 probably benign Het
Phf20 CCCCCCCCC CCCCCCCCCCCCCCCC 2: 156,304,620 probably benign Het
Phf20 CCCCCCCC CCCCCCCCCCCCCCC 2: 156,304,621 probably benign Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Rbm33 CCAGCCGCAGC CCAGC 5: 28,394,181 probably benign Het
Rubcnl T C 14: 75,044,438 F445S probably damaging Het
S100a10 TTTTTTTA T 3: 93,564,234 probably benign Het
Sbp AA AAAATGCTGACAACGGA 17: 23,945,354 probably benign Het
Sec14l3 A C 11: 4,067,963 Q81P possibly damaging Het
Setd1a TGGTGGTGG TGGTGGTGGGGGTGGTGG 7: 127,785,343 probably benign Het
Six3 CGG CGGGGG 17: 85,621,368 probably benign Het
Snapc5 ATGGAAGAAGAGG A 9: 64,182,211 probably benign Het
Tbc1d12 CGGAGGAGG CGG 19: 38,836,957 probably benign Het
Tcof1 AGC AGCCGC 18: 60,835,739 probably benign Het
Tmem28 CGCCGC CGCCGCAGCCGC X: 99,821,361 probably benign Het
Tox2 A G 2: 163,225,564 I68V probably benign Het
Triml2 G T 8: 43,183,164 probably benign Het
Tspan33 A G 6: 29,716,730 Y162C probably damaging Het
Zfp384 GGCCCAGGCCCA GGCCCAGGCCCAAGCCCAGGCCCA 6: 125,036,476 probably benign Het
Zfp948 T C 17: 21,588,312 Y589H probably damaging Het
Zic1 T C 9: 91,364,330 I230V probably benign Het
Other mutations in Kcnh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Kcnh8 APN 17 52834680 missense probably damaging 1.00
IGL01901:Kcnh8 APN 17 52894120 splice site probably benign
IGL01959:Kcnh8 APN 17 52834607 missense probably damaging 1.00
IGL02214:Kcnh8 APN 17 52877911 missense possibly damaging 0.88
IGL02528:Kcnh8 APN 17 52803528 missense probably damaging 1.00
IGL02620:Kcnh8 APN 17 52898497 missense probably damaging 0.99
IGL02688:Kcnh8 APN 17 52959443 missense probably benign 0.00
IGL02931:Kcnh8 APN 17 52956622 missense probably benign 0.00
IGL02950:Kcnh8 APN 17 52956767 missense probably benign 0.22
Incompetent UTSW 17 52894101 missense probably damaging 1.00
leak UTSW 17 52725906 small deletion probably benign
R0282:Kcnh8 UTSW 17 52725851 missense probably damaging 1.00
R0448:Kcnh8 UTSW 17 52977620 splice site probably null
R0496:Kcnh8 UTSW 17 52725858 missense probably benign 0.19
R0601:Kcnh8 UTSW 17 52894005 missense probably damaging 1.00
R0671:Kcnh8 UTSW 17 52978113 nonsense probably null
R0891:Kcnh8 UTSW 17 52905214 missense probably damaging 1.00
R0971:Kcnh8 UTSW 17 52725899 missense probably benign 0.00
R1054:Kcnh8 UTSW 17 52803484 missense probably damaging 1.00
R1237:Kcnh8 UTSW 17 52893960 missense probably damaging 1.00
R1237:Kcnh8 UTSW 17 52893961 missense probably damaging 1.00
R1565:Kcnh8 UTSW 17 52956881 missense probably benign
R1657:Kcnh8 UTSW 17 52839125 missense probably damaging 1.00
R1669:Kcnh8 UTSW 17 52893968 missense probably damaging 1.00
R1786:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R1803:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1804:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1929:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1980:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1981:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1982:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2016:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2017:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2132:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R2133:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R2208:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2265:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2266:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2267:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2303:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2309:Kcnh8 UTSW 17 52978039 missense probably damaging 1.00
R2760:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2764:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2857:Kcnh8 UTSW 17 52977933 missense probably benign
R2898:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2987:Kcnh8 UTSW 17 52956735 missense probably benign 0.05
R3031:Kcnh8 UTSW 17 52725906 small deletion probably benign
R3157:Kcnh8 UTSW 17 52725906 small deletion probably benign
R3158:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4080:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4081:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4082:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4087:Kcnh8 UTSW 17 52803400 missense possibly damaging 0.93
R4132:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4158:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4213:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4301:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4302:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4383:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4385:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4400:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4490:Kcnh8 UTSW 17 52961877 critical splice donor site probably null
R4493:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4494:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4611:Kcnh8 UTSW 17 52602836 missense probably benign 0.22
R4728:Kcnh8 UTSW 17 52725870 missense probably damaging 1.00
R4810:Kcnh8 UTSW 17 52905220 splice site probably null
R4927:Kcnh8 UTSW 17 52877981 missense probably damaging 1.00
R4984:Kcnh8 UTSW 17 52877967 missense probably damaging 1.00
R5017:Kcnh8 UTSW 17 52893930 missense probably damaging 1.00
R5214:Kcnh8 UTSW 17 52898458 missense probably damaging 1.00
R5272:Kcnh8 UTSW 17 52905015 missense probably damaging 0.97
R5386:Kcnh8 UTSW 17 52725995 missense probably benign 0.10
R5472:Kcnh8 UTSW 17 52977816 missense possibly damaging 0.71
R5500:Kcnh8 UTSW 17 52725980 missense probably benign 0.00
R5714:Kcnh8 UTSW 17 52978122 missense probably benign 0.31
R5866:Kcnh8 UTSW 17 52956776 missense probably benign 0.05
R5903:Kcnh8 UTSW 17 52803336 missense possibly damaging 0.87
R6969:Kcnh8 UTSW 17 52877943 nonsense probably null
R6994:Kcnh8 UTSW 17 52977695 missense probably benign 0.02
R7101:Kcnh8 UTSW 17 52905010 missense probably damaging 1.00
R7189:Kcnh8 UTSW 17 52894117 splice site probably null
R7228:Kcnh8 UTSW 17 52956716 missense probably benign 0.01
R7372:Kcnh8 UTSW 17 52894101 missense probably damaging 1.00
R7751:Kcnh8 UTSW 17 52961843 missense probably damaging 1.00
R7819:Kcnh8 UTSW 17 52956715 missense probably benign
R7952:Kcnh8 UTSW 17 52959465 missense probably benign 0.02
R8176:Kcnh8 UTSW 17 52978094 missense probably damaging 1.00
R8190:Kcnh8 UTSW 17 52956908 missense probably damaging 1.00
R8407:Kcnh8 UTSW 17 52905073 missense probably damaging 1.00
R8473:Kcnh8 UTSW 17 52978292 missense probably benign
R8716:Kcnh8 UTSW 17 52977752 missense probably benign 0.02
RF009:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
RF010:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
RF021:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
RF022:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
Z1088:Kcnh8 UTSW 17 52725890 missense probably damaging 1.00
Z1088:Kcnh8 UTSW 17 52978292 missense probably benign
Z1176:Kcnh8 UTSW 17 52894061 missense probably damaging 0.98
Z1177:Kcnh8 UTSW 17 52803471 missense probably damaging 1.00
Z1177:Kcnh8 UTSW 17 52978093 missense possibly damaging 0.91
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04