Incidental Mutation 'RF011:Mbd1'
Institutional Source Beutler Lab
Gene Symbol Mbd1
Ensembl Gene ENSMUSG00000024561
Gene Namemethyl-CpG binding domain protein 1
SynonymsPCM1, Cxxc3
Accession Numbers

NCBI RefSeq: NM_013594.2; MGI:1333811

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF011 (G1)
Quality Score217.637
Status Not validated
Chromosomal Location74267605-74282732 bp(+) (GRCm38)
Type of Mutationsmall deletion (8 aa in frame mutation)
DNA Base Change (assembly) GTCTTCGTCTGCATCTGCATCTGCATCT to GTCT at 74273610 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097530] [ENSMUST00000224047] [ENSMUST00000224332]
Predicted Effect probably benign
Transcript: ENSMUST00000097530
SMART Domains Protein: ENSMUSP00000095137
Gene: ENSMUSG00000024561

MBD 3 76 3.94e-27 SMART
low complexity region 82 97 N/A INTRINSIC
low complexity region 123 153 N/A INTRINSIC
Pfam:zf-CXXC 194 241 1.9e-13 PFAM
Pfam:zf-CXXC 243 288 1.2e-13 PFAM
low complexity region 358 368 N/A INTRINSIC
low complexity region 513 527 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224047
Predicted Effect probably benign
Transcript: ENSMUST00000224332
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype Strain: 2664084
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of nuclear proteins related by the presence of a methyl-CpG binding domain (MBD). These proteins are capable of binding specifically to methylated DNA, and some members can also repress transcription from methylated gene promoters. This protein contains multiple domains: MBD at the N-terminus that functions both in binding to methylated DNA and in protein interactions; several CXXC-type zinc finger domains that mediate binding to non-methylated CpG dinucleotides; transcriptional repression domain (TRD) at the C-terminus that is involved in transcription repression and in protein interactions. Numerous alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null exhibited defects in adult hippocampal neurogenesis and function. Spatial learning was also impaired in mutant mice. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,743,609 K672R possibly damaging Het
A030005L19Rik GTGGTGGCTG GTGGTGGCTGTGGTGGCTG 1: 82,913,569 probably benign Het
A030005L19Rik TGGCTGCTG TGGCTGCTGGGGCTGCTG 1: 82,913,573 probably benign Het
A030005L19Rik TGCTG TGCTGTGGCGGCTG 1: 82,913,586 probably benign Het
AI837181 GCG GCGTCG 19: 5,425,236 probably benign Het
Ankrd24 C CGGAGGCAGAGGA 10: 81,643,571 probably benign Het
Aqp2 T C 15: 99,583,872 S216P probably damaging Het
Cacna1f GGA GGAAGA X: 7,620,056 probably benign Het
Ccdc170 CCA CCAGCA 10: 4,561,018 probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,712,528 probably benign Het
Cela2a T C 4: 141,821,715 N117D probably benign Het
Cul9 CTTC CTTCTTC 17: 46,500,848 probably benign Het
Cyb5r2 A T 7: 107,751,168 S235R probably benign Het
Dnmt1 TT TTTTGGGGGCGGAGCACAGTTCCTACCTCGAT 9: 20,910,144 probably null Het
E4f1 CCG CCGTCG 17: 24,455,186 probably benign Het
Fam171b TCCAGCA TCCAGCACCAGCA 2: 83,812,873 probably benign Het
Fam171b GC GCAGCATC 2: 83,812,895 probably benign Het
Fam81b CTGTT CTGTTGTT 13: 76,271,316 probably benign Het
Fkbp1a GCCGCCGCCA G 2: 151,542,699 probably null Het
Flii G A 11: 60,716,243 A969V probably benign Het
Gas1 G GAAA 13: 60,176,531 probably benign Het
Grip1 A G 10: 119,931,315 D115G probably null Het
Guca2b G T 4: 119,656,847 T89N possibly damaging Het
Hcn4 T A 9: 58,859,915 S920T unknown Het
Heatr1 A G 13: 12,407,544 M484V probably benign Het
Iba57 G T 11: 59,163,612 A27E probably benign Het
Ifi207 G C 1: 173,729,121 L684V not run Het
Ints13 T C 6: 146,556,240 H380R probably damaging Het
Jmjd1c C T 10: 67,220,199 T466I possibly damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Kif12 C CCTCCACCCGGCGGGG 4: 63,171,427 probably benign Het
Kmt2c A T 5: 25,338,459 D1399E probably damaging Het
Macf1 A T 4: 123,473,855 L2371Q probably damaging Het
Med12l GCA GCATCA 3: 59,275,980 probably benign Het
Mgam C A 6: 40,757,436 Q1472K probably damaging Het
Mup21 TATACTT TATACTTTTTAGATACTT 4: 62,149,345 probably benign Het
Nipal1 A G 5: 72,666,813 N167D probably damaging Het
Olfr1105 T A 2: 87,034,041 Y60F probably damaging Het
Olfr1426 C T 19: 12,088,247 V182I probably benign Het
Osbpl3 CCTGCA C 6: 50,348,138 probably benign Het
Phf20 CCCCCCCCC CCCCCCCCCCCCCCCC 2: 156,304,620 probably benign Het
Phf20 CCCCCCCC CCCCCCCCCCCCCCC 2: 156,304,621 probably benign Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Rbm33 CCAGCCGCAGC CCAGC 5: 28,394,181 probably benign Het
Rubcnl T C 14: 75,044,438 F445S probably damaging Het
S100a10 TTTTTTTA T 3: 93,564,234 probably benign Het
Sbp AA AAAATGCTGACAACGGA 17: 23,945,354 probably benign Het
Sec14l3 A C 11: 4,067,963 Q81P possibly damaging Het
Setd1a TGGTGGTGG TGGTGGTGGGGGTGGTGG 7: 127,785,343 probably benign Het
Six3 CGG CGGGGG 17: 85,621,368 probably benign Het
Snapc5 ATGGAAGAAGAGG A 9: 64,182,211 probably benign Het
Tbc1d12 CGGAGGAGG CGG 19: 38,836,957 probably benign Het
Tcof1 AGC AGCCGC 18: 60,835,739 probably benign Het
Tmem28 CGCCGC CGCCGCAGCCGC X: 99,821,361 probably benign Het
Tox2 A G 2: 163,225,564 I68V probably benign Het
Triml2 G T 8: 43,183,164 probably benign Het
Tspan33 A G 6: 29,716,730 Y162C probably damaging Het
Zfp384 GGCCCAGGCCCA GGCCCAGGCCCAAGCCCAGGCCCA 6: 125,036,476 probably benign Het
Zfp948 T C 17: 21,588,312 Y589H probably damaging Het
Zic1 T C 9: 91,364,330 I230V probably benign Het
Other mutations in Mbd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Mbd1 APN 18 74275239 missense possibly damaging 0.72
IGL01551:Mbd1 APN 18 74269543 unclassified probably benign
IGL02213:Mbd1 APN 18 74275382 missense probably damaging 1.00
IGL02562:Mbd1 APN 18 74276922 missense probably benign 0.00
IGL02596:Mbd1 APN 18 74276797 splice site probably benign
IGL02944:Mbd1 APN 18 74277410 missense probably damaging 1.00
IGL02973:Mbd1 APN 18 74275427 splice site probably benign
IGL03200:Mbd1 APN 18 74276431 missense probably benign 0.02
IGL03247:Mbd1 APN 18 74274754 nonsense probably null
IGL03340:Mbd1 APN 18 74274482 missense probably benign 0.00
Shortbread UTSW 18 74274057 critical splice donor site probably null
FR4737:Mbd1 UTSW 18 74273573 small deletion probably benign
P0016:Mbd1 UTSW 18 74274538 nonsense probably null
R0385:Mbd1 UTSW 18 74273241 frame shift probably null
R0630:Mbd1 UTSW 18 74276727 splice site probably benign
R0717:Mbd1 UTSW 18 74273597 missense possibly damaging 0.89
R1084:Mbd1 UTSW 18 74269532 missense probably damaging 1.00
R1290:Mbd1 UTSW 18 74269486 missense possibly damaging 0.59
R1575:Mbd1 UTSW 18 74275419 critical splice donor site probably null
R2065:Mbd1 UTSW 18 74276884 missense probably damaging 1.00
R2192:Mbd1 UTSW 18 74277378 missense probably damaging 0.99
R2308:Mbd1 UTSW 18 74276477 missense probably benign 0.42
R2697:Mbd1 UTSW 18 74273617 missense possibly damaging 0.95
R3407:Mbd1 UTSW 18 74277367 missense possibly damaging 0.94
R4348:Mbd1 UTSW 18 74274416 missense probably damaging 1.00
R4664:Mbd1 UTSW 18 74269526 missense possibly damaging 0.86
R5460:Mbd1 UTSW 18 74269510 missense probably benign 0.03
R5860:Mbd1 UTSW 18 74276697 nonsense probably null
R6431:Mbd1 UTSW 18 74273691 splice site probably null
R6734:Mbd1 UTSW 18 74276043 missense probably damaging 1.00
R6861:Mbd1 UTSW 18 74273574
R7363:Mbd1 UTSW 18 74273286 missense probably damaging 0.97
R7543:Mbd1 UTSW 18 74274449 missense probably damaging 0.97
R7657:Mbd1 UTSW 18 74274733 missense probably damaging 0.99
R7871:Mbd1 UTSW 18 74274057 critical splice donor site probably null
R8960:Mbd1 UTSW 18 74273819 critical splice donor site probably null
RF005:Mbd1 UTSW 18 74273573 small deletion probably benign
RF024:Mbd1 UTSW 18 74273573 small deletion probably benign
RF024:Mbd1 UTSW 18 74273610 small deletion probably benign
RF058:Mbd1 UTSW 18 74273609 frame shift probably null
Z1177:Mbd1 UTSW 18 74276939 missense probably null 0.72
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04