Incidental Mutation 'RF011:Cacna1f'
ID603240
Institutional Source Beutler Lab
Gene Symbol Cacna1f
Ensembl Gene ENSMUSG00000031142
Gene Namecalcium channel, voltage-dependent, alpha 1F subunit
SynonymsCav1.4, Sfc17
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF011 (G1)
Quality Score139.467
Status Not validated
ChromosomeX
Chromosomal Location7607083-7635196 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) GGA to GGAAGA at 7620056 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115725] [ENSMUST00000115726] [ENSMUST00000133637] [ENSMUST00000155090]
Predicted Effect probably benign
Transcript: ENSMUST00000115725
SMART Domains Protein: ENSMUSP00000111390
Gene: ENSMUSG00000031142

DomainStartEndE-ValueType
Pfam:Ion_trans 129 371 9.3e-59 PFAM
PDB:4DEY|B 372 415 2e-21 PDB
low complexity region 455 469 N/A INTRINSIC
low complexity region 479 491 N/A INTRINSIC
transmembrane domain 525 547 N/A INTRINSIC
Pfam:Ion_trans 563 757 3.8e-44 PFAM
coiled coil region 806 834 N/A INTRINSIC
Pfam:Ion_trans 909 1139 1.1e-50 PFAM
Pfam:Ion_trans 1227 1436 2.7e-64 PFAM
Pfam:PKD_channel 1272 1443 1e-10 PFAM
Blast:EFh 1457 1485 2e-8 BLAST
Ca_chan_IQ 1571 1605 3.71e-14 SMART
low complexity region 1636 1655 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115726
SMART Domains Protein: ENSMUSP00000111391
Gene: ENSMUSG00000031142

DomainStartEndE-ValueType
Pfam:Ion_trans 91 383 2.1e-70 PFAM
low complexity region 455 469 N/A INTRINSIC
low complexity region 479 491 N/A INTRINSIC
low complexity region 509 525 N/A INTRINSIC
Pfam:Ion_trans 528 768 3.8e-54 PFAM
coiled coil region 806 834 N/A INTRINSIC
Pfam:Ion_trans 873 1151 2.4e-59 PFAM
Pfam:Ion_trans 1192 1455 2.6e-67 PFAM
Pfam:PKD_channel 1285 1450 8.5e-10 PFAM
Pfam:GPHH 1457 1526 2.7e-37 PFAM
Ca_chan_IQ 1578 1612 3.71e-14 SMART
Pfam:CAC1F_C 1622 1983 1.5e-164 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133637
SMART Domains Protein: ENSMUSP00000116051
Gene: ENSMUSG00000031142

DomainStartEndE-ValueType
transmembrane domain 96 115 N/A INTRINSIC
Pfam:Ion_trans 129 371 4.8e-59 PFAM
PDB:4DEY|B 372 415 9e-22 PDB
low complexity region 455 469 N/A INTRINSIC
low complexity region 479 491 N/A INTRINSIC
transmembrane domain 525 547 N/A INTRINSIC
Pfam:Ion_trans 563 757 2.2e-44 PFAM
low complexity region 822 832 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155090
SMART Domains Protein: ENSMUSP00000138116
Gene: ENSMUSG00000031142

DomainStartEndE-ValueType
transmembrane domain 96 115 N/A INTRINSIC
Pfam:Ion_trans 129 371 1.1e-59 PFAM
PDB:4DEY|B 372 415 4e-22 PDB
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multipass transmembrane protein that functions as an alpha-1 subunit of the voltage-dependent calcium channel, which mediates the influx of calcium ions into the cell. The encoded protein forms a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Mutations in this gene can cause X-linked eye disorders, including congenital stationary night blindness type 2A, cone-rod dystropy, and Aland Island eye disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous or hemizygous mutation of this gene results in impaired eye electrophysiology, abnormal retinal neuronal layer, bipolar cell, and horizontal cell morphology, and impaired retinal synapse morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,743,609 K672R possibly damaging Het
A030005L19Rik GTGGTGGCTG GTGGTGGCTGTGGTGGCTG 1: 82,913,569 probably benign Het
A030005L19Rik TGGCTGCTG TGGCTGCTGGGGCTGCTG 1: 82,913,573 probably benign Het
A030005L19Rik TGCTG TGCTGTGGCGGCTG 1: 82,913,586 probably benign Het
AI837181 GCG GCGTCG 19: 5,425,236 probably benign Het
Ankrd24 C CGGAGGCAGAGGA 10: 81,643,571 probably benign Het
Aqp2 T C 15: 99,583,872 S216P probably damaging Het
Ccdc170 CCA CCAGCA 10: 4,561,018 probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,712,528 probably benign Het
Cela2a T C 4: 141,821,715 N117D probably benign Het
Cul9 CTTC CTTCTTC 17: 46,500,848 probably benign Het
Cyb5r2 A T 7: 107,751,168 S235R probably benign Het
Dnmt1 CACAGTTCCTACCTCGTT CACAGTTCCTACCTCGTTTTGGGGGCGGAGAACAGTTCCTACCTCGTT 9: 20,910,128 probably null Het
Dnmt1 TT TTTTGGGGGCGGAGCACAGTTCCTACCTCGAT 9: 20,910,144 probably null Het
E4f1 CCG CCGTCG 17: 24,455,186 probably benign Het
Fam171b TCCAGCA TCCAGCACCAGCA 2: 83,812,873 probably benign Het
Fam171b GC GCAGCATC 2: 83,812,895 probably benign Het
Fam81b CTGTT CTGTTGTT 13: 76,271,316 probably benign Het
Fkbp1a GCCGCCGCCA G 2: 151,542,699 probably null Het
Flii G A 11: 60,716,243 A969V probably benign Het
Fscb AGTGGAACTTCTGCAGGCCCCTCTTCAGTTAGTGTAGGTGGAACTTCTGCAGGCCCCTCTTCAGTTAGTGGAGGTGGAACTTCTGCAGG AGTGGAACTTCTGCAGGCCCCTCTTCAGTTAGTGGAGGTGGAACTTCTGCAGG 12: 64,472,994 probably benign Het
Gas1 G GAAA 13: 60,176,531 probably benign Het
Grip1 A G 10: 119,931,315 D115G probably null Het
Guca2b G T 4: 119,656,847 T89N possibly damaging Het
Hcn4 T A 9: 58,859,915 S920T unknown Het
Heatr1 A G 13: 12,407,544 M484V probably benign Het
Iba57 G T 11: 59,163,612 A27E probably benign Het
Ifi207 G C 1: 173,729,121 L684V not run Het
Ints13 T C 6: 146,556,240 H380R probably damaging Het
Jmjd1c C T 10: 67,220,199 T466I possibly damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Kif12 C CCTCCACCCGGCGGGG 4: 63,171,427 probably benign Het
Kmt2c A T 5: 25,338,459 D1399E probably damaging Het
Macf1 A T 4: 123,473,855 L2371Q probably damaging Het
Mbd1 GTCTTCGTCTGCATCTGCATCTGCATCT GTCT 18: 74,273,610 probably benign Het
Med12l GCA GCATCA 3: 59,275,980 probably benign Het
Mgam C A 6: 40,757,436 Q1472K probably damaging Het
Mup21 TATACTT TATACTTTTTAGATACTT 4: 62,149,345 probably benign Het
Nipal1 A G 5: 72,666,813 N167D probably damaging Het
Olfr1105 T A 2: 87,034,041 Y60F probably damaging Het
Olfr1426 C T 19: 12,088,247 V182I probably benign Het
Osbpl3 CCTGCA C 6: 50,348,138 probably benign Het
Phf20 CCCCCCCCC CCCCCCCCCCCCCCCC 2: 156,304,620 probably benign Het
Phf20 CCCCCCCC CCCCCCCCCCCCCCC 2: 156,304,621 probably benign Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Rassf6 TCCTGTAGAGCAATGGGGATTC TCCTGTAGAGCAATGGGGATTCTGCCTCACTCATGGGCCTGTAGAGCAATGGGGATTC 5: 90,608,921 probably benign Het
Rbm33 CCAGCCGCAGC CCAGC 5: 28,394,181 probably benign Het
Rubcnl T C 14: 75,044,438 F445S probably damaging Het
S100a10 TTTTTTTA T 3: 93,564,234 probably benign Het
Sbp AA AAAATGCTGACAACGGA 17: 23,945,354 probably benign Het
Sec14l3 A C 11: 4,067,963 Q81P possibly damaging Het
Setd1a TGGTGGTGG TGGTGGTGGGGGTGGTGG 7: 127,785,343 probably benign Het
Six3 CGG CGGGGG 17: 85,621,368 probably benign Het
Snapc5 ATGGAAGAAGAGG A 9: 64,182,211 probably benign Het
Tbc1d12 CGGAGGAGG CGG 19: 38,836,957 probably benign Het
Tcof1 AGC AGCCGC 18: 60,835,739 probably benign Het
Tmem28 CGCCGC CGCCGCAGCCGC X: 99,821,361 probably benign Het
Tox2 A G 2: 163,225,564 I68V probably benign Het
Triml2 G T 8: 43,183,164 probably benign Het
Tspan33 A G 6: 29,716,730 Y162C probably damaging Het
Zfp384 GGCCCAGGCCCA GGCCCAGGCCCAAGCCCAGGCCCA 6: 125,036,476 probably benign Het
Zfp948 T C 17: 21,588,312 Y589H probably damaging Het
Zic1 T C 9: 91,364,330 I230V probably benign Het
Other mutations in Cacna1f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00796:Cacna1f APN X 7631031 missense probably damaging 1.00
IGL01693:Cacna1f APN X 7625367 missense probably damaging 1.00
IGL02143:Cacna1f APN X 7613995 intron probably benign
IGL02167:Cacna1f APN X 7616019 missense probably damaging 1.00
IGL02381:Cacna1f APN X 7616068 missense probably damaging 1.00
IGL02466:Cacna1f APN X 7629405 splice site probably null
IGL03006:Cacna1f APN X 7626903 missense probably damaging 1.00
FR4304:Cacna1f UTSW X 7620061 utr 3 prime probably benign
FR4340:Cacna1f UTSW X 7620067 utr 3 prime probably benign
FR4548:Cacna1f UTSW X 7620058 utr 3 prime probably benign
R0629:Cacna1f UTSW X 7620434 missense probably damaging 0.99
R1791:Cacna1f UTSW X 7620439 missense probably damaging 0.99
R2507:Cacna1f UTSW X 7626448 splice site probably null
R2508:Cacna1f UTSW X 7626448 splice site probably null
R4195:Cacna1f UTSW X 7608930 missense probably damaging 1.00
R4365:Cacna1f UTSW X 7609974 missense probably damaging 1.00
R4366:Cacna1f UTSW X 7609974 missense probably damaging 1.00
R8111:Cacna1f UTSW X 7621087 missense probably damaging 1.00
RF025:Cacna1f UTSW X 7620057 nonsense probably null
RF026:Cacna1f UTSW X 7620075 nonsense probably null
RF027:Cacna1f UTSW X 7620054 nonsense probably null
RF028:Cacna1f UTSW X 7620060 utr 3 prime probably benign
RF028:Cacna1f UTSW X 7620063 utr 3 prime probably benign
RF032:Cacna1f UTSW X 7620063 nonsense probably null
RF035:Cacna1f UTSW X 7620054 nonsense probably null
RF040:Cacna1f UTSW X 7618971 frame shift probably null
RF044:Cacna1f UTSW X 7620057 nonsense probably null
RF056:Cacna1f UTSW X 7620075 nonsense probably null
RF060:Cacna1f UTSW X 7620060 utr 3 prime probably benign
Z1088:Cacna1f UTSW X 7610251 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTGCATATAACACTCACTAGGC -3'
(R):5'- ATACATCTGTGGCCCACTGC -3'

Sequencing Primer
(F):5'- TGTCCCAGCGCTGTTCTAAGAG -3'
(R):5'- CCTCCTGGGTAGTTCTAGGGC -3'
Posted On2019-12-04