Incidental Mutation 'RF012:Pou2f1'
ID603247
Institutional Source Beutler Lab
Gene Symbol Pou2f1
Ensembl Gene ENSMUSG00000026565
Gene NamePOU domain, class 2, transcription factor 1
Synonymsoct-1, Otf1, Oct-1C, Otf-1, Oct-1B, Oct1, Oct-1z, 2810482H01Rik, Oct-1A
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF012 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location165865154-166002678 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 165913231 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 134 (T134I)
Ref Sequence ENSEMBL: ENSMUSP00000124738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027850] [ENSMUST00000069609] [ENSMUST00000111426] [ENSMUST00000111427] [ENSMUST00000111429] [ENSMUST00000159212] [ENSMUST00000160260] [ENSMUST00000160908] [ENSMUST00000177358] [ENSMUST00000184643]
Predicted Effect unknown
Transcript: ENSMUST00000027850
AA Change: T134I
SMART Domains Protein: ENSMUSP00000027850
Gene: ENSMUSG00000026565
AA Change: T134I

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 94 123 N/A INTRINSIC
low complexity region 137 152 N/A INTRINSIC
low complexity region 171 192 N/A INTRINSIC
low complexity region 199 217 N/A INTRINSIC
POU 241 315 1.55e-52 SMART
low complexity region 316 332 N/A INTRINSIC
HOX 342 404 2.54e-19 SMART
low complexity region 422 448 N/A INTRINSIC
low complexity region 453 520 N/A INTRINSIC
low complexity region 529 567 N/A INTRINSIC
low complexity region 675 685 N/A INTRINSIC
low complexity region 688 705 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000069609
AA Change: T123I
SMART Domains Protein: ENSMUSP00000064000
Gene: ENSMUSG00000026565
AA Change: T123I

DomainStartEndE-ValueType
low complexity region 83 112 N/A INTRINSIC
low complexity region 130 172 N/A INTRINSIC
low complexity region 189 204 N/A INTRINSIC
low complexity region 223 244 N/A INTRINSIC
low complexity region 251 269 N/A INTRINSIC
POU 293 367 1.55e-52 SMART
low complexity region 368 384 N/A INTRINSIC
HOX 394 456 2.54e-19 SMART
low complexity region 474 500 N/A INTRINSIC
low complexity region 505 572 N/A INTRINSIC
low complexity region 581 619 N/A INTRINSIC
low complexity region 727 737 N/A INTRINSIC
low complexity region 740 757 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111426
AA Change: T123I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107055
Gene: ENSMUSG00000026565
AA Change: T123I

DomainStartEndE-ValueType
low complexity region 83 112 N/A INTRINSIC
low complexity region 130 172 N/A INTRINSIC
low complexity region 189 204 N/A INTRINSIC
low complexity region 223 244 N/A INTRINSIC
low complexity region 251 269 N/A INTRINSIC
POU 293 367 6.7e-55 SMART
low complexity region 368 384 N/A INTRINSIC
HOX 394 456 1.3e-21 SMART
low complexity region 474 500 N/A INTRINSIC
low complexity region 531 596 N/A INTRINSIC
low complexity region 605 643 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000111427
AA Change: T123I
SMART Domains Protein: ENSMUSP00000107056
Gene: ENSMUSG00000026565
AA Change: T123I

DomainStartEndE-ValueType
low complexity region 83 112 N/A INTRINSIC
low complexity region 130 172 N/A INTRINSIC
low complexity region 189 204 N/A INTRINSIC
low complexity region 223 244 N/A INTRINSIC
low complexity region 251 269 N/A INTRINSIC
POU 293 367 1.55e-52 SMART
low complexity region 368 384 N/A INTRINSIC
HOX 394 456 2.54e-19 SMART
low complexity region 474 500 N/A INTRINSIC
low complexity region 531 596 N/A INTRINSIC
low complexity region 605 643 N/A INTRINSIC
low complexity region 751 761 N/A INTRINSIC
low complexity region 764 781 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000111429
AA Change: T111I
SMART Domains Protein: ENSMUSP00000107057
Gene: ENSMUSG00000026565
AA Change: T111I

DomainStartEndE-ValueType
low complexity region 71 100 N/A INTRINSIC
low complexity region 118 160 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
low complexity region 211 232 N/A INTRINSIC
low complexity region 239 257 N/A INTRINSIC
POU 281 355 6.7e-55 SMART
low complexity region 356 372 N/A INTRINSIC
HOX 382 444 1.3e-21 SMART
low complexity region 462 488 N/A INTRINSIC
low complexity region 493 560 N/A INTRINSIC
low complexity region 569 607 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159212
AA Change: T18I

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125371
Gene: ENSMUSG00000026565
AA Change: T18I

DomainStartEndE-ValueType
low complexity region 71 100 N/A INTRINSIC
low complexity region 118 160 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
low complexity region 211 232 N/A INTRINSIC
low complexity region 239 257 N/A INTRINSIC
POU 281 355 1.55e-52 SMART
low complexity region 356 372 N/A INTRINSIC
HOX 382 444 2.54e-19 SMART
low complexity region 462 488 N/A INTRINSIC
low complexity region 493 560 N/A INTRINSIC
low complexity region 569 607 N/A INTRINSIC
low complexity region 715 725 N/A INTRINSIC
low complexity region 728 745 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000160260
AA Change: T134I
SMART Domains Protein: ENSMUSP00000124738
Gene: ENSMUSG00000026565
AA Change: T134I

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 94 123 N/A INTRINSIC
low complexity region 141 183 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
low complexity region 234 255 N/A INTRINSIC
low complexity region 262 280 N/A INTRINSIC
POU 304 378 1.55e-52 SMART
low complexity region 379 395 N/A INTRINSIC
HOX 405 467 2.54e-19 SMART
low complexity region 485 511 N/A INTRINSIC
low complexity region 542 607 N/A INTRINSIC
low complexity region 616 654 N/A INTRINSIC
low complexity region 762 772 N/A INTRINSIC
low complexity region 775 792 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000160908
AA Change: T134I
SMART Domains Protein: ENSMUSP00000125444
Gene: ENSMUSG00000026565
AA Change: T134I

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 94 123 N/A INTRINSIC
low complexity region 141 183 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
low complexity region 234 255 N/A INTRINSIC
low complexity region 262 280 N/A INTRINSIC
POU 304 378 1.55e-52 SMART
low complexity region 379 395 N/A INTRINSIC
HOX 405 467 2.54e-19 SMART
low complexity region 485 511 N/A INTRINSIC
low complexity region 516 583 N/A INTRINSIC
low complexity region 592 630 N/A INTRINSIC
low complexity region 738 748 N/A INTRINSIC
low complexity region 751 768 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000177358
AA Change: T111I
SMART Domains Protein: ENSMUSP00000135565
Gene: ENSMUSG00000026565
AA Change: T111I

DomainStartEndE-ValueType
low complexity region 71 100 N/A INTRINSIC
low complexity region 118 160 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000184643
AA Change: T111I
SMART Domains Protein: ENSMUSP00000138962
Gene: ENSMUSG00000026565
AA Change: T111I

DomainStartEndE-ValueType
low complexity region 71 100 N/A INTRINSIC
low complexity region 118 160 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
low complexity region 211 232 N/A INTRINSIC
low complexity region 239 257 N/A INTRINSIC
POU 281 355 6.7e-55 SMART
low complexity region 356 372 N/A INTRINSIC
HOX 382 444 1.3e-21 SMART
low complexity region 462 488 N/A INTRINSIC
low complexity region 493 560 N/A INTRINSIC
low complexity region 569 607 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency 89% (56/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The OCT1 transcription factor was among the first identified members of the POU transcription factor family (summarized by Sturm et al., 1993 [PubMed 8314572]). Members of this family contain the POU domain, a 160-amino acid region necessary for DNA binding to the octameric sequence ATGCAAAT.[supplied by OMIM, Jul 2010]
PHENOTYPE: Homozygous mutation of this gene results in prenatal lethality, with earlier lethality on either a 129/Sv or C57BL/6 background than a mixed 129/Sv and C57BL/6 background. Embryos show decreased erythropoiesis and partial penetrance of small lens size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b T A 12: 113,489,932 L123Q probably damaging Het
AI837181 GCG GCGTCG 19: 5,425,227 probably benign Het
Akr1e1 T A 13: 4,595,126 N242I probably damaging Het
Ankrd7 G C 6: 18,869,275 E194Q possibly damaging Het
Ano3 A G 2: 110,697,523 F517L possibly damaging Het
Arhgef4 CAAA C 1: 34,724,484 probably benign Het
Arid1a AGACGACGA AGACGA 4: 133,752,820 probably benign Het
Atp2c2 G T 8: 119,745,514 A436S possibly damaging Het
BC004004 T A 17: 29,282,808 V107E probably benign Het
Begain CGCCGC CGCCGCAGCCGC 12: 109,033,427 probably benign Het
C87499 T A 4: 88,627,769 R445S probably damaging Het
Cad GT G 5: 31,060,212 probably benign Het
Chil1 A T 1: 134,185,171 T122S probably benign Het
Clic6 A G 16: 92,530,809 S501G possibly damaging Het
Col6a3 A C 1: 90,810,560 L1079R probably damaging Het
Coro2a T C 4: 46,542,336 K346E probably damaging Het
Ctsf A G 19: 4,858,666 N325D probably benign Het
Dchs2 A G 3: 83,355,068 E2881G probably benign Het
Dnah14 A G 1: 181,627,898 T863A probably damaging Het
Dnaic2 A T 11: 114,750,416 I356F probably damaging Het
Dusp4 ACGGCGGCGGCGGC ACGGCGGCGGC 8: 34,807,799 probably benign Het
Efhb T C 17: 53,413,517 N647D probably damaging Het
Efhd2 CCG CCGACGGCG 4: 141,874,768 probably benign Het
Eif3i A G 4: 129,592,079 Y318H probably damaging Het
Fbxl5 T C 5: 43,773,505 H80R probably damaging Het
Gab3 TCT TCTGCT X: 75,000,020 probably benign Het
Gne G T 4: 44,060,045 A147D probably damaging Het
Gpi1 A T 7: 34,202,477 H538Q probably damaging Het
Itih2 T C 2: 10,117,403 H229R possibly damaging Het
Kdm7a A G 6: 39,206,513 V41A probably damaging Het
Krtap28-10 GCCACA GCCACACCCACA 1: 83,042,136 probably benign Het
Lipa A T 19: 34,509,098 S141R probably damaging Het
Medag G T 5: 149,411,994 C6F probably benign Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,030 probably benign Het
Nefh GACTTGGCCTCACCTGGG GACTTGGCCTCACCTGGGTACTTGGCCTCACCTGGG 11: 4,941,032 probably benign Het
Nefh GGCCTCT GGCCTCTCCTGGGGACTTTGCCTCT 11: 4,941,055 probably benign Het
Olfr1150-ps1 A T 2: 87,846,759 I163L probably benign Het
Opa1 A G 16: 29,613,966 I482M probably damaging Het
Pgf T C 12: 85,169,542 probably null Het
Pkhd1l1 TTTT TTTTTTTTTTTATTT 15: 44,558,505 probably benign Het
Prss52 A G 14: 64,113,473 S236G probably damaging Het
Rpsa A G 9: 120,131,039 T223A probably benign Het
Shprh A G 10: 11,164,841 N686S probably benign Het
Six3 CGG CGGTGG 17: 85,621,368 probably benign Het
Six4 TG T 12: 73,103,582 probably null Het
Slc22a27 C T 19: 7,926,584 G63S probably benign Het
Tmcc2 G T 1: 132,361,018 N310K probably damaging Het
Tmem144 A T 3: 79,822,654 L263Q probably damaging Het
Tpra1 T C 6: 88,909,342 V101A probably damaging Het
Troap T C 15: 99,075,400 S16P probably benign Het
Ttn T C 2: 76,713,571 T33024A probably benign Het
Usp2 A ACATGTGACCTGTTCTTCACTTACT 9: 44,089,130 probably benign Het
Was CTCCTCCT C X: 8,086,231 probably null Het
Zfp672 A G 11: 58,316,112 V461A probably benign Het
Other mutations in Pou2f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Pou2f1 APN 1 165902298 missense probably damaging 1.00
IGL00392:Pou2f1 APN 1 165896590 splice site probably benign
IGL01627:Pou2f1 APN 1 165880433 unclassified probably benign
IGL01707:Pou2f1 APN 1 165915116 missense probably damaging 0.96
IGL02735:Pou2f1 APN 1 165875827 missense probably damaging 1.00
IGL02740:Pou2f1 APN 1 165883116 nonsense probably null
IGL03117:Pou2f1 APN 1 165934813 missense probably benign 0.00
IGL03272:Pou2f1 APN 1 165896480 missense possibly damaging 0.67
R0021:Pou2f1 UTSW 1 165876018 missense probably damaging 1.00
R1437:Pou2f1 UTSW 1 165891830 missense probably damaging 0.98
R2171:Pou2f1 UTSW 1 165880356 unclassified probably benign
R3722:Pou2f1 UTSW 1 165894969 missense probably damaging 1.00
R3789:Pou2f1 UTSW 1 165894969 missense probably damaging 1.00
R3790:Pou2f1 UTSW 1 165894969 missense probably damaging 1.00
R3901:Pou2f1 UTSW 1 165894969 missense probably damaging 1.00
R4225:Pou2f1 UTSW 1 165911320 missense possibly damaging 0.79
R4459:Pou2f1 UTSW 1 165895006 missense probably damaging 1.00
R4460:Pou2f1 UTSW 1 165895006 missense probably damaging 1.00
R4573:Pou2f1 UTSW 1 165913261 missense probably benign 0.29
R4820:Pou2f1 UTSW 1 165891948 intron probably benign
R4838:Pou2f1 UTSW 1 165916923 missense probably null 1.00
R5579:Pou2f1 UTSW 1 165915162 missense probably damaging 1.00
R5856:Pou2f1 UTSW 1 165915130 missense probably benign 0.14
R5951:Pou2f1 UTSW 1 165883056 unclassified probably benign
R6128:Pou2f1 UTSW 1 165875487 unclassified probably benign
R6145:Pou2f1 UTSW 1 165875433 unclassified probably benign
R6216:Pou2f1 UTSW 1 165880320 unclassified probably benign
R6971:Pou2f1 UTSW 1 165931689 missense probably damaging 0.98
R7052:Pou2f1 UTSW 1 165915115 missense possibly damaging 0.59
R7403:Pou2f1 UTSW 1 165911386 missense unknown
R7404:Pou2f1 UTSW 1 165911386 missense unknown
R7741:Pou2f1 UTSW 1 165875875 missense probably damaging 0.98
R8011:Pou2f1 UTSW 1 165894903 critical splice donor site probably null
X0022:Pou2f1 UTSW 1 165896456 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAATGCCTGCAGCTGTAAC -3'
(R):5'- AAATTTAAGAGTGCACCAGTAGAC -3'

Sequencing Primer
(F):5'- TGCCTGCAGCTGTAACAAAAAG -3'
(R):5'- TGCACCAGTAGACAAAAAGGC -3'
Posted On2019-12-04