Incidental Mutation 'RF012:Olfr1150-ps1'
ID603251
Institutional Source Beutler Lab
Gene Symbol Olfr1150-ps1
Ensembl Gene ENSMUSG00000070853
Gene Nameolfactory receptor 1150, pseudogene 1
SynonymsMOR264-11, GA_x6K02T2Q125-49347783-49348734
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #RF012 (G1)
Quality Score217.009
Status Validated
Chromosome2
Chromosomal Location87843993-87849541 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87846759 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 163 (I163L)
Ref Sequence ENSEMBL: ENSMUSP00000150363 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000121186
AA Change: I163L

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency 89% (56/63)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b T A 12: 113,489,932 L123Q probably damaging Het
AI837181 GCG GCGTCG 19: 5,425,227 probably benign Het
Akr1e1 T A 13: 4,595,126 N242I probably damaging Het
Ankrd7 G C 6: 18,869,275 E194Q possibly damaging Het
Ano3 A G 2: 110,697,523 F517L possibly damaging Het
Arhgef4 CAAA C 1: 34,724,484 probably benign Het
Arid1a AGACGACGA AGACGA 4: 133,752,820 probably benign Het
Atp2c2 G T 8: 119,745,514 A436S possibly damaging Het
BC004004 T A 17: 29,282,808 V107E probably benign Het
Begain CGCCGC CGCCGCAGCCGC 12: 109,033,427 probably benign Het
C87499 T A 4: 88,627,769 R445S probably damaging Het
Cad GT G 5: 31,060,212 probably benign Het
Chil1 A T 1: 134,185,171 T122S probably benign Het
Clic6 A G 16: 92,530,809 S501G possibly damaging Het
Col6a3 A C 1: 90,810,560 L1079R probably damaging Het
Coro2a T C 4: 46,542,336 K346E probably damaging Het
Ctsf A G 19: 4,858,666 N325D probably benign Het
Dchs2 A G 3: 83,355,068 E2881G probably benign Het
Dnah14 A G 1: 181,627,898 T863A probably damaging Het
Dnaic2 A T 11: 114,750,416 I356F probably damaging Het
Dusp4 ACGGCGGCGGCGGC ACGGCGGCGGC 8: 34,807,799 probably benign Het
Efhb T C 17: 53,413,517 N647D probably damaging Het
Efhd2 CCG CCGACGGCG 4: 141,874,768 probably benign Het
Eif3i A G 4: 129,592,079 Y318H probably damaging Het
Fbxl5 T C 5: 43,773,505 H80R probably damaging Het
Gab3 TCT TCTGCT X: 75,000,020 probably benign Het
Gne G T 4: 44,060,045 A147D probably damaging Het
Gpi1 A T 7: 34,202,477 H538Q probably damaging Het
Itih2 T C 2: 10,117,403 H229R possibly damaging Het
Kdm7a A G 6: 39,206,513 V41A probably damaging Het
Krtap28-10 GCCACA GCCACACCCACA 1: 83,042,136 probably benign Het
Lipa A T 19: 34,509,098 S141R probably damaging Het
Medag G T 5: 149,411,994 C6F probably benign Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,030 probably benign Het
Nefh GACTTGGCCTCACCTGGG GACTTGGCCTCACCTGGGTACTTGGCCTCACCTGGG 11: 4,941,032 probably benign Het
Nefh GGCCTCT GGCCTCTCCTGGGGACTTTGCCTCT 11: 4,941,055 probably benign Het
Opa1 A G 16: 29,613,966 I482M probably damaging Het
Pgf T C 12: 85,169,542 probably null Het
Pkhd1l1 TTTT TTTTTTTTTTTATTT 15: 44,558,505 probably benign Het
Pou2f1 G A 1: 165,913,231 T134I unknown Het
Prss52 A G 14: 64,113,473 S236G probably damaging Het
Rpsa A G 9: 120,131,039 T223A probably benign Het
Shprh A G 10: 11,164,841 N686S probably benign Het
Six3 CGG CGGTGG 17: 85,621,368 probably benign Het
Six4 TG T 12: 73,103,582 probably null Het
Slc22a27 C T 19: 7,926,584 G63S probably benign Het
Tmcc2 G T 1: 132,361,018 N310K probably damaging Het
Tmem144 A T 3: 79,822,654 L263Q probably damaging Het
Tpra1 T C 6: 88,909,342 V101A probably damaging Het
Troap T C 15: 99,075,400 S16P probably benign Het
Ttn T C 2: 76,713,571 T33024A probably benign Het
Usp2 A ACATGTGACCTGTTCTTCACTTACT 9: 44,089,130 probably benign Het
Was CTCCTCCT C X: 8,086,231 probably null Het
Zfp672 A G 11: 58,316,112 V461A probably benign Het
Other mutations in Olfr1150-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R5985:Olfr1150-ps1 UTSW 2 87357605 missense probably benign 0.01
R6494:Olfr1150-ps1 UTSW 2 87357632 nonsense probably null
R7419:Olfr1150-ps1 UTSW 2 87847062 missense probably benign 0.41
R7450:Olfr1150-ps1 UTSW 2 87846459 missense probably damaging 0.98
R7913:Olfr1150-ps1 UTSW 2 87846693 missense probably benign
R7994:Olfr1150-ps1 UTSW 2 87846693 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTGCCACACAAATGTCCTTC -3'
(R):5'- CTGTTGGCAACCTAAGGATGG -3'

Sequencing Primer
(F):5'- GCCACACAAATGTCCTTCTTCCTTG -3'
(R):5'- TTGCTGTAGGATGCAAGCACC -3'
Posted On2019-12-04