Incidental Mutation 'RF012:Gne'
ID603255
Institutional Source Beutler Lab
Gene Symbol Gne
Ensembl Gene ENSMUSG00000028479
Gene Nameglucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF012 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location44034075-44084177 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 44060045 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 147 (A147D)
Ref Sequence ENSEMBL: ENSMUSP00000030201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030201] [ENSMUST00000102936] [ENSMUST00000128439] [ENSMUST00000133709] [ENSMUST00000140724] [ENSMUST00000144985] [ENSMUST00000172533] [ENSMUST00000173234] [ENSMUST00000173274] [ENSMUST00000173383]
Predicted Effect probably damaging
Transcript: ENSMUST00000030201
AA Change: A147D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030201
Gene: ENSMUSG00000028479
AA Change: A147D

DomainStartEndE-ValueType
Pfam:Epimerase_2 63 406 2.3e-69 PFAM
Pfam:ROK 440 747 1.4e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102936
AA Change: A116D

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000100000
Gene: ENSMUSG00000028479
AA Change: A116D

DomainStartEndE-ValueType
Pfam:Epimerase_2 32 375 5.1e-75 PFAM
Pfam:ROK 411 596 6.5e-44 PFAM
low complexity region 685 707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128439
Predicted Effect probably benign
Transcript: ENSMUST00000133709
Predicted Effect probably benign
Transcript: ENSMUST00000140724
Predicted Effect probably damaging
Transcript: ENSMUST00000144985
AA Change: A155D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118443
Gene: ENSMUSG00000028479
AA Change: A155D

DomainStartEndE-ValueType
Pfam:Epimerase_2 71 213 1.3e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172533
AA Change: A116D

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134040
Gene: ENSMUSG00000028479
AA Change: A116D

DomainStartEndE-ValueType
Pfam:Epimerase_2 32 375 1.6e-75 PFAM
PDB:3EO3|C 406 471 2e-33 PDB
SCOP:d1bu6o1 410 462 1e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173234
AA Change: A116D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133521
Gene: ENSMUSG00000028479
AA Change: A116D

DomainStartEndE-ValueType
Pfam:Epimerase_2 32 375 3.9e-75 PFAM
Pfam:ROK 453 522 1.6e-16 PFAM
low complexity region 611 633 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173274
AA Change: A116D

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134406
Gene: ENSMUSG00000028479
AA Change: A116D

DomainStartEndE-ValueType
Pfam:Epimerase_2 32 292 2.5e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173383
AA Change: A116D

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133440
Gene: ENSMUSG00000028479
AA Change: A116D

DomainStartEndE-ValueType
Pfam:Epimerase_2 32 133 3.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174522
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency 89% (56/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a bifunctional enzyme that initiates and regulates the biosynthesis of N-acetylneuraminic acid (NeuAc), a precursor of sialic acids. It is a rate-limiting enzyme in the sialic acid biosynthetic pathway. Sialic acid modification of cell surface molecules is crucial for their function in many biologic processes, including cell adhesion and signal transduction. Differential sialylation of cell surface molecules is also implicated in the tumorigenicity and metastatic behavior of malignant cells. Mutations in this gene are associated with sialuria, autosomal recessive inclusion body myopathy, and Nonaka myopathy. Alternative splicing of this gene results in transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene causes a block in sialic acid biosynthesis and early embryonic lethality. A knockout mouse expressing the human V572L mutation shows features similar to distal myopathy with rimmed vacuoles or hereditary inclusion body myopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b T A 12: 113,489,932 L123Q probably damaging Het
AI837181 GCG GCGTCG 19: 5,425,227 probably benign Het
Akr1e1 T A 13: 4,595,126 N242I probably damaging Het
Ankrd7 G C 6: 18,869,275 E194Q possibly damaging Het
Ano3 A G 2: 110,697,523 F517L possibly damaging Het
Arhgef4 CAAA C 1: 34,724,484 probably benign Het
Arid1a AGACGACGA AGACGA 4: 133,752,820 probably benign Het
Atp2c2 G T 8: 119,745,514 A436S possibly damaging Het
BC004004 T A 17: 29,282,808 V107E probably benign Het
Begain CGCCGC CGCCGCAGCCGC 12: 109,033,427 probably benign Het
C87499 T A 4: 88,627,769 R445S probably damaging Het
Cad GT G 5: 31,060,212 probably benign Het
Chil1 A T 1: 134,185,171 T122S probably benign Het
Clic6 A G 16: 92,530,809 S501G possibly damaging Het
Col6a3 A C 1: 90,810,560 L1079R probably damaging Het
Coro2a T C 4: 46,542,336 K346E probably damaging Het
Ctsf A G 19: 4,858,666 N325D probably benign Het
Dchs2 A G 3: 83,355,068 E2881G probably benign Het
Dnah14 A G 1: 181,627,898 T863A probably damaging Het
Dnaic2 A T 11: 114,750,416 I356F probably damaging Het
Dusp4 ACGGCGGCGGCGGC ACGGCGGCGGC 8: 34,807,799 probably benign Het
Efhb T C 17: 53,413,517 N647D probably damaging Het
Efhd2 CCG CCGACGGCG 4: 141,874,768 probably benign Het
Eif3i A G 4: 129,592,079 Y318H probably damaging Het
Fbxl5 T C 5: 43,773,505 H80R probably damaging Het
Gab3 TCT TCTGCT X: 75,000,020 probably benign Het
Gpi1 A T 7: 34,202,477 H538Q probably damaging Het
Itih2 T C 2: 10,117,403 H229R possibly damaging Het
Kdm7a A G 6: 39,206,513 V41A probably damaging Het
Krtap28-10 GCCACA GCCACACCCACA 1: 83,042,136 probably benign Het
Lipa A T 19: 34,509,098 S141R probably damaging Het
Medag G T 5: 149,411,994 C6F probably benign Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,030 probably benign Het
Nefh GACTTGGCCTCACCTGGG GACTTGGCCTCACCTGGGTACTTGGCCTCACCTGGG 11: 4,941,032 probably benign Het
Nefh GGCCTCT GGCCTCTCCTGGGGACTTTGCCTCT 11: 4,941,055 probably benign Het
Olfr1150-ps1 A T 2: 87,846,759 I163L probably benign Het
Opa1 A G 16: 29,613,966 I482M probably damaging Het
Pgf T C 12: 85,169,542 probably null Het
Pkhd1l1 TTTT TTTTTTTTTTTATTT 15: 44,558,505 probably benign Het
Pou2f1 G A 1: 165,913,231 T134I unknown Het
Prss52 A G 14: 64,113,473 S236G probably damaging Het
Rpsa A G 9: 120,131,039 T223A probably benign Het
Shprh A G 10: 11,164,841 N686S probably benign Het
Six3 CGG CGGTGG 17: 85,621,368 probably benign Het
Six4 TG T 12: 73,103,582 probably null Het
Slc22a27 C T 19: 7,926,584 G63S probably benign Het
Tmcc2 G T 1: 132,361,018 N310K probably damaging Het
Tmem144 A T 3: 79,822,654 L263Q probably damaging Het
Tpra1 T C 6: 88,909,342 V101A probably damaging Het
Troap T C 15: 99,075,400 S16P probably benign Het
Ttn T C 2: 76,713,571 T33024A probably benign Het
Usp2 A ACATGTGACCTGTTCTTCACTTACT 9: 44,089,130 probably benign Het
Was CTCCTCCT C X: 8,086,231 probably null Het
Zfp672 A G 11: 58,316,112 V461A probably benign Het
Other mutations in Gne
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01451:Gne APN 4 44041860 splice site probably null
IGL02028:Gne APN 4 44066852 missense probably damaging 1.00
IGL02106:Gne APN 4 44037306 missense probably damaging 1.00
IGL02216:Gne APN 4 44044761 missense probably benign 0.43
IGL03095:Gne APN 4 44055211 missense probably damaging 1.00
R0069:Gne UTSW 4 44060099 missense probably damaging 1.00
R0069:Gne UTSW 4 44060099 missense probably damaging 1.00
R0310:Gne UTSW 4 44060157 nonsense probably null
R0606:Gne UTSW 4 44042244 missense possibly damaging 0.55
R0658:Gne UTSW 4 44039033 missense possibly damaging 0.85
R1878:Gne UTSW 4 44040434 missense probably damaging 1.00
R2009:Gne UTSW 4 44055273 missense probably benign 0.00
R2338:Gne UTSW 4 44042196 missense probably damaging 0.99
R4043:Gne UTSW 4 44040383 missense possibly damaging 0.65
R4361:Gne UTSW 4 44059947 missense possibly damaging 0.63
R4725:Gne UTSW 4 44066806 missense probably benign 0.31
R4869:Gne UTSW 4 44055204 critical splice donor site probably null
R5511:Gne UTSW 4 44041843 missense probably damaging 0.99
R5797:Gne UTSW 4 44060030 missense probably damaging 1.00
R6016:Gne UTSW 4 44039063 missense probably damaging 0.99
R6176:Gne UTSW 4 44053019 intron probably benign
R6461:Gne UTSW 4 44060078 missense probably damaging 1.00
R6804:Gne UTSW 4 44060210 missense probably damaging 1.00
R7170:Gne UTSW 4 44040361 missense possibly damaging 0.95
R7191:Gne UTSW 4 44040266 missense probably benign 0.16
R7264:Gne UTSW 4 44042175 missense probably damaging 0.96
R7413:Gne UTSW 4 44044857 missense probably benign 0.06
R7956:Gne UTSW 4 44044962 missense probably benign 0.32
R8184:Gne UTSW 4 44084061 missense probably benign 0.07
R8734:Gne UTSW 4 44072911 unclassified probably benign
RF014:Gne UTSW 4 44060045 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGTTTGTCATAGGAAGGGC -3'
(R):5'- CATACCGCATGATTGAGCAAGATG -3'

Sequencing Primer
(F):5'- GTCGTGGTCCTCGCACATAGAG -3'
(R):5'- GATGACTTTGACATTAACACCAGGC -3'
Posted On2019-12-04