Incidental Mutation 'RF012:Dusp4'
ID603272
Institutional Source Beutler Lab
Gene Symbol Dusp4
Ensembl Gene ENSMUSG00000031530
Gene Namedual specificity phosphatase 4
SynonymsMKP2, E130306H24Rik, 2700078F24Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #RF012 (G1)
Quality Score137.249
Status Validated
Chromosome8
Chromosomal Location34807297-34819894 bp(+) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) ACGGCGGCGGCGGC to ACGGCGGCGGC at 34807799 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000033930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033930]
Predicted Effect probably benign
Transcript: ENSMUST00000033930
SMART Domains Protein: ENSMUSP00000033930
Gene: ENSMUSG00000031530

DomainStartEndE-ValueType
RHOD 35 160 4.16e-15 SMART
DSPc 199 337 2.91e-64 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency 89% (56/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates ERK1, ERK2 and JNK, is expressed in a variety of tissues, and is localized in the nucleus. Two alternatively spliced transcript variants, encoding distinct isoforms, have been observed for this gene. In addition, multiple polyadenylation sites have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit a decrease in B cell apoptosis of bone marrow-derived, IL-7-dependent pro-B lymphocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b T A 12: 113,489,932 L123Q probably damaging Het
AI837181 GCG GCGTCG 19: 5,425,227 probably benign Het
Akr1e1 T A 13: 4,595,126 N242I probably damaging Het
Ankrd7 G C 6: 18,869,275 E194Q possibly damaging Het
Ano3 A G 2: 110,697,523 F517L possibly damaging Het
Arhgef4 CAAA C 1: 34,724,484 probably benign Het
Arid1a AGACGACGA AGACGA 4: 133,752,820 probably benign Het
Atp2c2 G T 8: 119,745,514 A436S possibly damaging Het
BC004004 T A 17: 29,282,808 V107E probably benign Het
Begain CGCCGC CGCCGCAGCCGC 12: 109,033,427 probably benign Het
C87499 T A 4: 88,627,769 R445S probably damaging Het
Cad GT G 5: 31,060,212 probably benign Het
Chil1 A T 1: 134,185,171 T122S probably benign Het
Clic6 A G 16: 92,530,809 S501G possibly damaging Het
Col6a3 A C 1: 90,810,560 L1079R probably damaging Het
Coro2a T C 4: 46,542,336 K346E probably damaging Het
Ctsf A G 19: 4,858,666 N325D probably benign Het
Dchs2 A G 3: 83,355,068 E2881G probably benign Het
Dnah14 A G 1: 181,627,898 T863A probably damaging Het
Dnaic2 A T 11: 114,750,416 I356F probably damaging Het
Efhb T C 17: 53,413,517 N647D probably damaging Het
Efhd2 CCG CCGACGGCG 4: 141,874,768 probably benign Het
Eif3i A G 4: 129,592,079 Y318H probably damaging Het
Fbxl5 T C 5: 43,773,505 H80R probably damaging Het
Gab3 TCT TCTGCT X: 75,000,020 probably benign Het
Gne G T 4: 44,060,045 A147D probably damaging Het
Gpi1 A T 7: 34,202,477 H538Q probably damaging Het
Itih2 T C 2: 10,117,403 H229R possibly damaging Het
Kdm7a A G 6: 39,206,513 V41A probably damaging Het
Krtap28-10 GCCACA GCCACACCCACA 1: 83,042,136 probably benign Het
Lipa A T 19: 34,509,098 S141R probably damaging Het
Medag G T 5: 149,411,994 C6F probably benign Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,030 probably benign Het
Nefh GACTTGGCCTCACCTGGG GACTTGGCCTCACCTGGGTACTTGGCCTCACCTGGG 11: 4,941,032 probably benign Het
Nefh GGCCTCT GGCCTCTCCTGGGGACTTTGCCTCT 11: 4,941,055 probably benign Het
Olfr1150-ps1 A T 2: 87,846,759 I163L probably benign Het
Opa1 A G 16: 29,613,966 I482M probably damaging Het
Pgf T C 12: 85,169,542 probably null Het
Pkhd1l1 TTTT TTTTTTTTTTTATTT 15: 44,558,505 probably benign Het
Pou2f1 G A 1: 165,913,231 T134I unknown Het
Prss52 A G 14: 64,113,473 S236G probably damaging Het
Rpsa A G 9: 120,131,039 T223A probably benign Het
Shprh A G 10: 11,164,841 N686S probably benign Het
Six3 CGG CGGTGG 17: 85,621,368 probably benign Het
Six4 TG T 12: 73,103,582 probably null Het
Slc22a27 C T 19: 7,926,584 G63S probably benign Het
Tmcc2 G T 1: 132,361,018 N310K probably damaging Het
Tmem144 A T 3: 79,822,654 L263Q probably damaging Het
Tpra1 T C 6: 88,909,342 V101A probably damaging Het
Troap T C 15: 99,075,400 S16P probably benign Het
Ttn T C 2: 76,713,571 T33024A probably benign Het
Usp2 A ACATGTGACCTGTTCTTCACTTACT 9: 44,089,130 probably benign Het
Was CTCCTCCT C X: 8,086,231 probably null Het
Zfp672 A G 11: 58,316,112 V461A probably benign Het
Other mutations in Dusp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Dusp4 APN 8 34818512 missense probably benign 0.35
IGL02948:Dusp4 APN 8 34818572 missense probably damaging 1.00
R1537:Dusp4 UTSW 8 34818416 missense probably benign 0.00
R1644:Dusp4 UTSW 8 34818479 missense probably damaging 1.00
R4492:Dusp4 UTSW 8 34807736 missense possibly damaging 0.56
R4826:Dusp4 UTSW 8 34818517 missense probably damaging 1.00
R5396:Dusp4 UTSW 8 34817304 missense probably damaging 1.00
R5637:Dusp4 UTSW 8 34817297 missense probably damaging 1.00
R6850:Dusp4 UTSW 8 34816497 nonsense probably null
R7078:Dusp4 UTSW 8 34807911 missense probably damaging 0.99
R8346:Dusp4 UTSW 8 34807938 missense possibly damaging 0.91
Z1177:Dusp4 UTSW 8 34808090 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TTTGCGGGTCACTTCTGCAG -3'
(R):5'- TAAGCAGGCAGATGTCCGTG -3'

Sequencing Primer
(F):5'- TCTGCAGGCGCCCTCTTAG -3'
(R):5'- TCGTAGACGATGACAGCCG -3'
Posted On2019-12-04