Incidental Mutation 'RF012:Atp2c2'
ID 603274
Institutional Source Beutler Lab
Gene Symbol Atp2c2
Ensembl Gene ENSMUSG00000034112
Gene Name ATPase, Ca++ transporting, type 2C, member 2
Synonyms 1810010G06Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # RF012 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 120426748-120484456 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 120472253 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 436 (A436S)
Ref Sequence ENSEMBL: ENSMUSP00000092794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095171]
AlphaFold A7L9Z8
Predicted Effect possibly damaging
Transcript: ENSMUST00000095171
AA Change: A436S

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092794
Gene: ENSMUSG00000034112
AA Change: A436S

DomainStartEndE-ValueType
Cation_ATPase_N 54 128 1.27e-12 SMART
Pfam:E1-E2_ATPase 133 366 1.7e-62 PFAM
Pfam:Hydrolase 371 684 5.3e-18 PFAM
Pfam:HAD 374 681 7.4e-11 PFAM
Pfam:Cation_ATPase 437 521 1.1e-17 PFAM
Pfam:Cation_ATPase_C 754 927 1.1e-47 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency 89% (56/63)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b T A 12: 113,453,552 (GRCm39) L123Q probably damaging Het
AI837181 GCG GCGTCG 19: 5,475,255 (GRCm39) probably benign Het
Akr1e1 T A 13: 4,645,125 (GRCm39) N242I probably damaging Het
Ankrd7 G C 6: 18,869,274 (GRCm39) E194Q possibly damaging Het
Ano3 A G 2: 110,527,868 (GRCm39) F517L possibly damaging Het
Arhgef4 CAAA C 1: 34,763,565 (GRCm39) probably benign Het
Arid1a AGACGACGA AGACGA 4: 133,480,131 (GRCm39) probably benign Het
BC004004 T A 17: 29,501,782 (GRCm39) V107E probably benign Het
Begain CGCCGC CGCCGCAGCCGC 12: 108,999,353 (GRCm39) probably benign Het
Cad GT G 5: 31,217,556 (GRCm39) probably benign Het
Chi3l1 A T 1: 134,112,909 (GRCm39) T122S probably benign Het
Clic6 A G 16: 92,327,697 (GRCm39) S501G possibly damaging Het
Col6a3 A C 1: 90,738,282 (GRCm39) L1079R probably damaging Het
Coro2a T C 4: 46,542,336 (GRCm39) K346E probably damaging Het
Ctsf A G 19: 4,908,694 (GRCm39) N325D probably benign Het
Dchs2 A G 3: 83,262,375 (GRCm39) E2881G probably benign Het
Dnah14 A G 1: 181,455,463 (GRCm39) T863A probably damaging Het
Dnai2 A T 11: 114,641,242 (GRCm39) I356F probably damaging Het
Dusp4 ACGGCGGCGGCGGC ACGGCGGCGGC 8: 35,274,953 (GRCm39) probably benign Het
Efhb T C 17: 53,720,545 (GRCm39) N647D probably damaging Het
Efhd2 CCG CCGACGGCG 4: 141,602,079 (GRCm39) probably benign Het
Eif3i A G 4: 129,485,872 (GRCm39) Y318H probably damaging Het
Fbxl5 T C 5: 43,930,847 (GRCm39) H80R probably damaging Het
Gab3 TCT TCTGCT X: 74,043,626 (GRCm39) probably benign Het
Gne G T 4: 44,060,045 (GRCm39) A147D probably damaging Het
Gpi1 A T 7: 33,901,902 (GRCm39) H538Q probably damaging Het
Itih2 T C 2: 10,122,214 (GRCm39) H229R possibly damaging Het
Kdm7a A G 6: 39,183,447 (GRCm39) V41A probably damaging Het
Krtap28-10 GCCACA GCCACACCCACA 1: 83,019,857 (GRCm39) probably benign Het
Lipa A T 19: 34,486,498 (GRCm39) S141R probably damaging Het
Medag G T 5: 149,335,459 (GRCm39) C6F probably benign Het
Nefh GGCCTCT GGCCTCTCCTGGGGACTTTGCCTCT 11: 4,891,055 (GRCm39) probably benign Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,891,030 (GRCm39) probably benign Het
Nefh GACTTGGCCTCACCTGGG GACTTGGCCTCACCTGGGTACTTGGCCTCACCTGGG 11: 4,891,032 (GRCm39) probably benign Het
Opa1 A G 16: 29,432,784 (GRCm39) I482M probably damaging Het
Or12e14 A T 2: 87,677,103 (GRCm39) I163L probably benign Het
Pgf T C 12: 85,216,316 (GRCm39) probably null Het
Pkhd1l1 TTTT TTTTTTTTTTTATTT 15: 44,421,901 (GRCm39) probably benign Het
Pou2f1 G A 1: 165,740,800 (GRCm39) T134I unknown Het
Pramel32 T A 4: 88,546,006 (GRCm39) R445S probably damaging Het
Prss52 A G 14: 64,350,922 (GRCm39) S236G probably damaging Het
Rpsa A G 9: 119,960,105 (GRCm39) T223A probably benign Het
Shprh A G 10: 11,040,585 (GRCm39) N686S probably benign Het
Six3 CGG CGGTGG 17: 85,928,796 (GRCm39) probably benign Het
Six4 TG T 12: 73,150,356 (GRCm39) probably null Het
Slc22a27 C T 19: 7,903,949 (GRCm39) G63S probably benign Het
Tmcc2 G T 1: 132,288,756 (GRCm39) N310K probably damaging Het
Tmem144 A T 3: 79,729,961 (GRCm39) L263Q probably damaging Het
Tpra1 T C 6: 88,886,324 (GRCm39) V101A probably damaging Het
Troap T C 15: 98,973,281 (GRCm39) S16P probably benign Het
Ttn T C 2: 76,543,915 (GRCm39) T33024A probably benign Het
Usp2 A ACATGTGACCTGTTCTTCACTTACT 9: 44,000,427 (GRCm39) probably benign Het
Was CTCCTCCT C X: 7,952,470 (GRCm39) probably null Het
Zfp672 A G 11: 58,206,938 (GRCm39) V461A probably benign Het
Other mutations in Atp2c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Atp2c2 APN 8 120,472,329 (GRCm39) missense probably benign
IGL01624:Atp2c2 APN 8 120,484,189 (GRCm39) missense probably benign 0.00
IGL02133:Atp2c2 APN 8 120,481,074 (GRCm39) missense probably benign 0.00
IGL02221:Atp2c2 APN 8 120,471,073 (GRCm39) missense probably damaging 1.00
IGL02606:Atp2c2 APN 8 120,457,013 (GRCm39) missense probably benign
IGL02657:Atp2c2 APN 8 120,479,771 (GRCm39) missense probably damaging 1.00
IGL02839:Atp2c2 APN 8 120,475,859 (GRCm39) missense possibly damaging 0.85
IGL03122:Atp2c2 APN 8 120,469,414 (GRCm39) missense possibly damaging 0.77
R0031:Atp2c2 UTSW 8 120,475,801 (GRCm39) missense probably benign 0.15
R0372:Atp2c2 UTSW 8 120,484,180 (GRCm39) missense probably benign
R0502:Atp2c2 UTSW 8 120,461,316 (GRCm39) missense probably null 0.99
R0503:Atp2c2 UTSW 8 120,461,316 (GRCm39) missense probably null 0.99
R0584:Atp2c2 UTSW 8 120,465,157 (GRCm39) missense probably benign 0.01
R1225:Atp2c2 UTSW 8 120,461,984 (GRCm39) missense probably damaging 1.00
R1580:Atp2c2 UTSW 8 120,479,726 (GRCm39) missense probably benign 0.00
R1620:Atp2c2 UTSW 8 120,475,865 (GRCm39) missense probably benign
R1638:Atp2c2 UTSW 8 120,482,742 (GRCm39) missense possibly damaging 0.82
R1745:Atp2c2 UTSW 8 120,451,833 (GRCm39) missense probably benign 0.02
R1746:Atp2c2 UTSW 8 120,461,182 (GRCm39) unclassified probably benign
R1907:Atp2c2 UTSW 8 120,476,615 (GRCm39) splice site probably benign
R2104:Atp2c2 UTSW 8 120,476,584 (GRCm39) missense probably benign
R2151:Atp2c2 UTSW 8 120,482,841 (GRCm39) missense probably benign
R2152:Atp2c2 UTSW 8 120,482,841 (GRCm39) missense probably benign
R2154:Atp2c2 UTSW 8 120,482,841 (GRCm39) missense probably benign
R2207:Atp2c2 UTSW 8 120,475,048 (GRCm39) missense probably damaging 1.00
R3874:Atp2c2 UTSW 8 120,462,035 (GRCm39) missense possibly damaging 0.74
R3912:Atp2c2 UTSW 8 120,448,015 (GRCm39) missense probably damaging 1.00
R4093:Atp2c2 UTSW 8 120,476,610 (GRCm39) critical splice donor site probably null
R4782:Atp2c2 UTSW 8 120,475,891 (GRCm39) missense probably damaging 0.97
R4801:Atp2c2 UTSW 8 120,474,426 (GRCm39) missense probably damaging 1.00
R4973:Atp2c2 UTSW 8 120,481,002 (GRCm39) missense probably benign 0.00
R5485:Atp2c2 UTSW 8 120,479,801 (GRCm39) critical splice donor site probably null
R5978:Atp2c2 UTSW 8 120,476,614 (GRCm39) splice site probably null
R6377:Atp2c2 UTSW 8 120,453,093 (GRCm39) missense probably benign 0.10
R6613:Atp2c2 UTSW 8 120,482,760 (GRCm39) missense probably damaging 0.99
R6765:Atp2c2 UTSW 8 120,479,756 (GRCm39) missense probably damaging 1.00
R6836:Atp2c2 UTSW 8 120,461,154 (GRCm39) missense probably damaging 1.00
R6963:Atp2c2 UTSW 8 120,457,006 (GRCm39) nonsense probably null
R7220:Atp2c2 UTSW 8 120,472,300 (GRCm39) missense probably benign 0.00
R7238:Atp2c2 UTSW 8 120,469,160 (GRCm39) missense possibly damaging 0.73
R7373:Atp2c2 UTSW 8 120,456,991 (GRCm39) missense probably benign 0.02
R7438:Atp2c2 UTSW 8 120,474,936 (GRCm39) missense probably damaging 1.00
R7573:Atp2c2 UTSW 8 120,478,008 (GRCm39) missense probably damaging 1.00
R7677:Atp2c2 UTSW 8 120,474,915 (GRCm39) missense probably benign 0.00
R7737:Atp2c2 UTSW 8 120,469,134 (GRCm39) missense probably damaging 1.00
R7912:Atp2c2 UTSW 8 120,456,917 (GRCm39) missense possibly damaging 0.81
R8821:Atp2c2 UTSW 8 120,476,033 (GRCm39) splice site probably null
R8831:Atp2c2 UTSW 8 120,476,033 (GRCm39) splice site probably null
R9200:Atp2c2 UTSW 8 120,474,999 (GRCm39) nonsense probably null
R9211:Atp2c2 UTSW 8 120,446,032 (GRCm39) missense probably benign
R9246:Atp2c2 UTSW 8 120,456,989 (GRCm39) missense probably damaging 1.00
R9285:Atp2c2 UTSW 8 120,465,141 (GRCm39) missense probably benign 0.00
RF004:Atp2c2 UTSW 8 120,479,561 (GRCm39) missense probably damaging 1.00
Z1177:Atp2c2 UTSW 8 120,461,124 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAGTCCTGAGTGTGGGG -3'
(R):5'- GGGTGGGAGAGTTCTTCCC -3'

Sequencing Primer
(F):5'- GGAGGGGAGCACACACCTG -3'
(R):5'- CCAAAACTTCTAGGCCAGTGAGTG -3'
Posted On 2019-12-04