Incidental Mutation 'RF012:Six3'
ID603300
Institutional Source Beutler Lab
Gene Symbol Six3
Ensembl Gene ENSMUSG00000038805
Gene Namesine oculis-related homeobox 3
SynonymsE130112M24Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF012 (G1)
Quality Score180.468
Status Not validated
Chromosome17
Chromosomal Location85613608-85629302 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) CGG to CGGTGG at 85621368 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162695] [ENSMUST00000175898] [ENSMUST00000176081]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159030
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160691
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161688
Predicted Effect probably benign
Transcript: ENSMUST00000162695
SMART Domains Protein: ENSMUSP00000125169
Gene: ENSMUSG00000038805

DomainStartEndE-ValueType
low complexity region 30 71 N/A INTRINSIC
HOX 208 269 1.26e-14 SMART
low complexity region 294 310 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175898
SMART Domains Protein: ENSMUSP00000135677
Gene: ENSMUSG00000038805

DomainStartEndE-ValueType
low complexity region 30 71 N/A INTRINSIC
HOX 208 269 1.26e-14 SMART
low complexity region 294 310 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175913
Predicted Effect probably benign
Transcript: ENSMUST00000176081
SMART Domains Protein: ENSMUSP00000135312
Gene: ENSMUSG00000038805

DomainStartEndE-ValueType
low complexity region 51 92 N/A INTRINSIC
Pfam:SIX1_SD 109 223 6e-47 PFAM
HOX 229 290 6.5e-17 SMART
low complexity region 315 331 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185134
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183495
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177487
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188560
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency 89% (56/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sine oculis homeobox transcription factor family. The encoded protein plays a role in eye development. Mutations in this gene have been associated with holoprosencephaly type 2. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for disruptions of this gene die at birth with anterior structures of the head and brain undeveloped. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b T A 12: 113,489,932 L123Q probably damaging Het
AI837181 GCG GCGTCG 19: 5,425,227 probably benign Het
Akr1e1 T A 13: 4,595,126 N242I probably damaging Het
Ankrd7 G C 6: 18,869,275 E194Q possibly damaging Het
Ano3 A G 2: 110,697,523 F517L possibly damaging Het
Arhgef4 CAAA C 1: 34,724,484 probably benign Het
Arid1a AGACGACGA AGACGA 4: 133,752,820 probably benign Het
Atp2c2 G T 8: 119,745,514 A436S possibly damaging Het
BC004004 T A 17: 29,282,808 V107E probably benign Het
Begain CGCCGC CGCCGCAGCCGC 12: 109,033,427 probably benign Het
C87499 T A 4: 88,627,769 R445S probably damaging Het
Cad GT G 5: 31,060,212 probably benign Het
Chil1 A T 1: 134,185,171 T122S probably benign Het
Clic6 A G 16: 92,530,809 S501G possibly damaging Het
Col6a3 A C 1: 90,810,560 L1079R probably damaging Het
Coro2a T C 4: 46,542,336 K346E probably damaging Het
Ctsf A G 19: 4,858,666 N325D probably benign Het
Dchs2 A G 3: 83,355,068 E2881G probably benign Het
Dnah14 A G 1: 181,627,898 T863A probably damaging Het
Dnaic2 A T 11: 114,750,416 I356F probably damaging Het
Dusp4 ACGGCGGCGGCGGC ACGGCGGCGGC 8: 34,807,799 probably benign Het
Efhb T C 17: 53,413,517 N647D probably damaging Het
Efhd2 CCG CCGACGGCG 4: 141,874,768 probably benign Het
Eif3i A G 4: 129,592,079 Y318H probably damaging Het
Fbxl5 T C 5: 43,773,505 H80R probably damaging Het
Gab3 TCT TCTGCT X: 75,000,020 probably benign Het
Gne G T 4: 44,060,045 A147D probably damaging Het
Gpi1 A T 7: 34,202,477 H538Q probably damaging Het
Itih2 T C 2: 10,117,403 H229R possibly damaging Het
Kdm7a A G 6: 39,206,513 V41A probably damaging Het
Krtap28-10 GCCACA GCCACACCCACA 1: 83,042,136 probably benign Het
Lipa A T 19: 34,509,098 S141R probably damaging Het
Medag G T 5: 149,411,994 C6F probably benign Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,030 probably benign Het
Nefh GACTTGGCCTCACCTGGG GACTTGGCCTCACCTGGGTACTTGGCCTCACCTGGG 11: 4,941,032 probably benign Het
Nefh GGCCTCT GGCCTCTCCTGGGGACTTTGCCTCT 11: 4,941,055 probably benign Het
Olfr1150-ps1 A T 2: 87,846,759 I163L probably benign Het
Opa1 A G 16: 29,613,966 I482M probably damaging Het
Pgf T C 12: 85,169,542 probably null Het
Pkhd1l1 TTTT TTTTTTTTTTTATTT 15: 44,558,505 probably benign Het
Pou2f1 G A 1: 165,913,231 T134I unknown Het
Prss52 A G 14: 64,113,473 S236G probably damaging Het
Rpsa A G 9: 120,131,039 T223A probably benign Het
Shprh A G 10: 11,164,841 N686S probably benign Het
Six4 TG T 12: 73,103,582 probably null Het
Slc22a27 C T 19: 7,926,584 G63S probably benign Het
Tmcc2 G T 1: 132,361,018 N310K probably damaging Het
Tmem144 A T 3: 79,822,654 L263Q probably damaging Het
Tpra1 T C 6: 88,909,342 V101A probably damaging Het
Troap T C 15: 99,075,400 S16P probably benign Het
Ttn T C 2: 76,713,571 T33024A probably benign Het
Usp2 A ACATGTGACCTGTTCTTCACTTACT 9: 44,089,130 probably benign Het
Was CTCCTCCT C X: 8,086,231 probably null Het
Zfp672 A G 11: 58,316,112 V461A probably benign Het
Other mutations in Six3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03096:Six3 APN 17 85621937 missense possibly damaging 0.78
IGL03397:Six3 APN 17 85621646 missense probably damaging 1.00
FR4304:Six3 UTSW 17 85621368 small insertion probably benign
FR4340:Six3 UTSW 17 85621356 small insertion probably benign
FR4449:Six3 UTSW 17 85621362 small insertion probably benign
FR4548:Six3 UTSW 17 85621363 small insertion probably benign
FR4589:Six3 UTSW 17 85621365 small insertion probably benign
FR4737:Six3 UTSW 17 85621357 small insertion probably benign
FR4737:Six3 UTSW 17 85621358 small insertion probably benign
FR4737:Six3 UTSW 17 85621362 small insertion probably benign
FR4737:Six3 UTSW 17 85621363 small insertion probably benign
FR4737:Six3 UTSW 17 85621365 small insertion probably benign
FR4737:Six3 UTSW 17 85621368 small insertion probably benign
FR4976:Six3 UTSW 17 85621358 small insertion probably benign
FR4976:Six3 UTSW 17 85621371 small insertion probably benign
R0238:Six3 UTSW 17 85621390 missense probably damaging 1.00
R1264:Six3 UTSW 17 85621857 missense probably damaging 0.96
R2903:Six3 UTSW 17 85623855 missense probably damaging 0.96
R2916:Six3 UTSW 17 85621633 missense probably benign 0.25
R4994:Six3 UTSW 17 85621292 missense possibly damaging 0.91
R5393:Six3 UTSW 17 85623842 missense possibly damaging 0.93
R6524:Six3 UTSW 17 85621970 missense probably damaging 1.00
RF003:Six3 UTSW 17 85621370 small insertion probably benign
RF010:Six3 UTSW 17 85621355 small insertion probably benign
RF011:Six3 UTSW 17 85621368 small insertion probably benign
RF014:Six3 UTSW 17 85621356 small insertion probably benign
RF015:Six3 UTSW 17 85621370 small insertion probably benign
RF022:Six3 UTSW 17 85621356 small insertion probably benign
RF054:Six3 UTSW 17 85621355 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TGAATCTTGACTCGGCCGTG -3'
(R):5'- GTTTGTTGATGGCCTCGCAC -3'

Sequencing Primer
(F):5'- GTGGGTGTCCCTTACGTCC -3'
(R):5'- CGATGTCGCCCGTCTCC -3'
Posted On2019-12-04