Incidental Mutation 'RF012:Ctsf'
ID603301
Institutional Source Beutler Lab
Gene Symbol Ctsf
Ensembl Gene ENSMUSG00000083282
Gene Namecathepsin F
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #RF012 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location4855129-4860912 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4858666 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 325 (N325D)
Ref Sequence ENSEMBL: ENSMUSP00000112481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006626] [ENSMUST00000119694]
Predicted Effect probably benign
Transcript: ENSMUST00000006626
SMART Domains Protein: ENSMUSP00000006626
Gene: ENSMUSG00000006457

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
CH 46 146 1.4e-23 SMART
CH 159 258 4.83e-27 SMART
low complexity region 261 272 N/A INTRINSIC
Pfam:Spectrin 287 397 5.5e-15 PFAM
SPEC 410 511 3.78e-23 SMART
SPEC 525 632 2.37e-6 SMART
Pfam:Spectrin 643 746 4.1e-15 PFAM
EFh 763 791 7.93e-1 SMART
EFh 799 827 5.96e-1 SMART
efhand_Ca_insen 830 896 2.29e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119694
AA Change: N325D

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000112481
Gene: ENSMUSG00000083282
AA Change: N325D

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 55 77 N/A INTRINSIC
low complexity region 111 122 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
Inhibitor_I29 165 222 5.41e-16 SMART
Pept_C1 249 460 4.2e-93 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency 89% (56/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cathepsins are papain family cysteine proteinases that represent a major component of the lysosomal proteolytic system. Cathepsins generally contain a signal sequence, followed by a propeptide and then a catalytically active mature region. The very long (251 amino acid residues) proregion of the cathepsin F precursor contains a C-terminal domain similar to the pro-segment of cathepsin L-like enzymes, a 50-residue flexible linker peptide, and an N-terminal domain predicted to adopt a cystatin-like fold. The cathepsin F proregion is unique within the papain family cysteine proteases in that it contains this additional N-terminal segment predicted to share structural similarities with cysteine protease inhibitors of the cystatin superfamily. This cystatin-like domain contains some of the elements known to be important for inhibitory activity. CTSF encodes a predicted protein of 484 amino acids which contains a 19 residue signal peptide. Cathepsin F contains five potential N-glycosylation sites, and it may be targeted to the endosomal/lysosomal compartment via the mannose 6-phosphate receptor pathway. The cathepsin F gene is ubiquitously expressed, and it maps to chromosome 11q13, close to the gene encoding cathepsin W. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele develop neuronal lipofuscinosis and late-onset neurological disease characterized by reduced brain mass, progressive hind leg weakness, impaired motor coordination, tremors, severe gliosis, general wasting, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b T A 12: 113,489,932 L123Q probably damaging Het
AI837181 GCG GCGTCG 19: 5,425,227 probably benign Het
Akr1e1 T A 13: 4,595,126 N242I probably damaging Het
Ankrd7 G C 6: 18,869,275 E194Q possibly damaging Het
Ano3 A G 2: 110,697,523 F517L possibly damaging Het
Arhgef4 CAAA C 1: 34,724,484 probably benign Het
Arid1a AGACGACGA AGACGA 4: 133,752,820 probably benign Het
Atp2c2 G T 8: 119,745,514 A436S possibly damaging Het
BC004004 T A 17: 29,282,808 V107E probably benign Het
Begain CGCCGC CGCCGCAGCCGC 12: 109,033,427 probably benign Het
C87499 T A 4: 88,627,769 R445S probably damaging Het
Cad GT G 5: 31,060,212 probably benign Het
Chil1 A T 1: 134,185,171 T122S probably benign Het
Clic6 A G 16: 92,530,809 S501G possibly damaging Het
Col6a3 A C 1: 90,810,560 L1079R probably damaging Het
Coro2a T C 4: 46,542,336 K346E probably damaging Het
Dchs2 A G 3: 83,355,068 E2881G probably benign Het
Dnah14 A G 1: 181,627,898 T863A probably damaging Het
Dnaic2 A T 11: 114,750,416 I356F probably damaging Het
Dusp4 ACGGCGGCGGCGGC ACGGCGGCGGC 8: 34,807,799 probably benign Het
Efhb T C 17: 53,413,517 N647D probably damaging Het
Efhd2 CCG CCGACGGCG 4: 141,874,768 probably benign Het
Eif3i A G 4: 129,592,079 Y318H probably damaging Het
Fbxl5 T C 5: 43,773,505 H80R probably damaging Het
Gab3 TCT TCTGCT X: 75,000,020 probably benign Het
Gne G T 4: 44,060,045 A147D probably damaging Het
Gpi1 A T 7: 34,202,477 H538Q probably damaging Het
Itih2 T C 2: 10,117,403 H229R possibly damaging Het
Kdm7a A G 6: 39,206,513 V41A probably damaging Het
Krtap28-10 GCCACA GCCACACCCACA 1: 83,042,136 probably benign Het
Lipa A T 19: 34,509,098 S141R probably damaging Het
Medag G T 5: 149,411,994 C6F probably benign Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,030 probably benign Het
Nefh GACTTGGCCTCACCTGGG GACTTGGCCTCACCTGGGTACTTGGCCTCACCTGGG 11: 4,941,032 probably benign Het
Nefh GGCCTCT GGCCTCTCCTGGGGACTTTGCCTCT 11: 4,941,055 probably benign Het
Olfr1150-ps1 A T 2: 87,846,759 I163L probably benign Het
Opa1 A G 16: 29,613,966 I482M probably damaging Het
Pgf T C 12: 85,169,542 probably null Het
Pkhd1l1 TTTT TTTTTTTTTTTATTT 15: 44,558,505 probably benign Het
Pou2f1 G A 1: 165,913,231 T134I unknown Het
Prss52 A G 14: 64,113,473 S236G probably damaging Het
Rpsa A G 9: 120,131,039 T223A probably benign Het
Shprh A G 10: 11,164,841 N686S probably benign Het
Six3 CGG CGGTGG 17: 85,621,368 probably benign Het
Six4 TG T 12: 73,103,582 probably null Het
Slc22a27 C T 19: 7,926,584 G63S probably benign Het
Tmcc2 G T 1: 132,361,018 N310K probably damaging Het
Tmem144 A T 3: 79,822,654 L263Q probably damaging Het
Tpra1 T C 6: 88,909,342 V101A probably damaging Het
Troap T C 15: 99,075,400 S16P probably benign Het
Ttn T C 2: 76,713,571 T33024A probably benign Het
Usp2 A ACATGTGACCTGTTCTTCACTTACT 9: 44,089,130 probably benign Het
Was CTCCTCCT C X: 8,086,231 probably null Het
Zfp672 A G 11: 58,316,112 V461A probably benign Het
Other mutations in Ctsf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:Ctsf APN 19 4858078 missense probably damaging 1.00
IGL01891:Ctsf APN 19 4856567 missense probably damaging 0.99
IGL03291:Ctsf APN 19 4859634 missense probably benign 0.00
R0587:Ctsf UTSW 19 4855738 missense probably benign 0.35
R0831:Ctsf UTSW 19 4859840 missense possibly damaging 0.92
R1808:Ctsf UTSW 19 4856534 missense probably benign 0.00
R5652:Ctsf UTSW 19 4858477 missense probably damaging 1.00
R5662:Ctsf UTSW 19 4856578 missense probably damaging 0.98
R6993:Ctsf UTSW 19 4858483 missense probably benign 0.45
R7702:Ctsf UTSW 19 4856539 missense probably damaging 1.00
R7703:Ctsf UTSW 19 4856539 missense probably damaging 1.00
R7704:Ctsf UTSW 19 4856539 missense probably damaging 1.00
R7705:Ctsf UTSW 19 4856539 missense probably damaging 1.00
R7962:Ctsf UTSW 19 4856539 missense probably damaging 1.00
R7965:Ctsf UTSW 19 4856539 missense probably damaging 1.00
R7966:Ctsf UTSW 19 4856539 missense probably damaging 1.00
Z1176:Ctsf UTSW 19 4856306 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTCTGTCACAGGCAACGTG -3'
(R):5'- GGTCCTTGTCATGCATCAGAATC -3'

Sequencing Primer
(F):5'- AGGGCCAGTGGTTCCTGAAC -3'
(R):5'- ACCTCACTTGCCATTGGAGAC -3'
Posted On2019-12-04