Mutagenetix > Incidental Mutations

Incidental Mutation 'RF012:Ctsf'

603301

Institutional Source

Beutler Lab

Gene Symbol

Ctsf

Ensembl Gene

ENSMUSG00000083282

Gene Name

cathepsin F

Synonyms

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.093) question?

Stock #

RF012 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

4855129-4860912 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 4858666 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 325 (N325D)

Ref Sequence

ENSEMBL: ENSMUSP00000112481 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006626] [ENSMUST00000119694]

Predicted Effect

probably benign
Transcript: ENSMUST00000006626

SMART Domains

Protein: ENSMUSP00000006626
Gene: ENSMUSG00000006457

Domain	Start	End	E-Value	Type
low complexity region	8	30	N/A	INTRINSIC
CH	46	146	1.4e-23	SMART
CH	159	258	4.83e-27	SMART
low complexity region	261	272	N/A	INTRINSIC
Pfam:Spectrin	287	397	5.5e-15	PFAM
SPEC	410	511	3.78e-23	SMART
SPEC	525	632	2.37e-6	SMART
Pfam:Spectrin	643	746	4.1e-15	PFAM
EFh	763	791	7.93e-1	SMART
EFh	799	827	5.96e-1	SMART
efhand_Ca_insen	830	896	2.29e-34	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000119694
AA Change: N325D

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000112481
Gene: ENSMUSG00000083282
AA Change: N325D

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	55	77	N/A	INTRINSIC
low complexity region	111	122	N/A	INTRINSIC
low complexity region	145	156	N/A	INTRINSIC
Inhibitor_I29	165	222	5.41e-16	SMART
Pept_C1	249	460	4.2e-93	SMART

Coding Region Coverage

1x: 99.8%
3x: 99.7%
10x: 99.4%
20x: 98.8%

Validation Efficiency

89% (56/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cathepsins are papain family cysteine proteinases that represent a major component of the lysosomal proteolytic system. Cathepsins generally contain a signal sequence, followed by a propeptide and then a catalytically active mature region. The very long (251 amino acid residues) proregion of the cathepsin F precursor contains a C-terminal domain similar to the pro-segment of cathepsin L-like enzymes, a 50-residue flexible linker peptide, and an N-terminal domain predicted to adopt a cystatin-like fold. The cathepsin F proregion is unique within the papain family cysteine proteases in that it contains this additional N-terminal segment predicted to share structural similarities with cysteine protease inhibitors of the cystatin superfamily. This cystatin-like domain contains some of the elements known to be important for inhibitory activity. CTSF encodes a predicted protein of 484 amino acids which contains a 19 residue signal peptide. Cathepsin F contains five potential N-glycosylation sites, and it may be targeted to the endosomal/lysosomal compartment via the mannose 6-phosphate receptor pathway. The cathepsin F gene is ubiquitously expressed, and it maps to chromosome 11q13, close to the gene encoding cathepsin W. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele develop neuronal lipofuscinosis and late-onset neurological disease characterized by reduced brain mass, progressive hind leg weakness, impaired motor coordination, tremors, severe gliosis, general wasting, and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam6b	T	A	12: 113,489,932	L123Q	probably damaging	Het
AI837181	GCG	GCGTCG	19: 5,425,227		probably benign	Het
Akr1e1	T	A	13: 4,595,126	N242I	probably damaging	Het
Ankrd7	G	C	6: 18,869,275	E194Q	possibly damaging	Het
Ano3	A	G	2: 110,697,523	F517L	possibly damaging	Het
Arhgef4	CAAA	C	1: 34,724,484		probably benign	Het
Arid1a	AGACGACGA	AGACGA	4: 133,752,820		probably benign	Het
Atp2c2	G	T	8: 119,745,514	A436S	possibly damaging	Het
BC004004	T	A	17: 29,282,808	V107E	probably benign	Het
Begain	CGCCGC	CGCCGCAGCCGC	12: 109,033,427		probably benign	Het
C87499	T	A	4: 88,627,769	R445S	probably damaging	Het
Cad	GT	G	5: 31,060,212		probably benign	Het
Chil1	A	T	1: 134,185,171	T122S	probably benign	Het
Clic6	A	G	16: 92,530,809	S501G	possibly damaging	Het
Col6a3	A	C	1: 90,810,560	L1079R	probably damaging	Het
Coro2a	T	C	4: 46,542,336	K346E	probably damaging	Het
Dchs2	A	G	3: 83,355,068	E2881G	probably benign	Het
Dnah14	A	G	1: 181,627,898	T863A	probably damaging	Het
Dnaic2	A	T	11: 114,750,416	I356F	probably damaging	Het
Dusp4	ACGGCGGCGGCGGC	ACGGCGGCGGC	8: 34,807,799		probably benign	Het
Efhb	T	C	17: 53,413,517	N647D	probably damaging	Het
Efhd2	CCG	CCGACGGCG	4: 141,874,768		probably benign	Het
Eif3i	A	G	4: 129,592,079	Y318H	probably damaging	Het
Fbxl5	T	C	5: 43,773,505	H80R	probably damaging	Het
Gab3	TCT	TCTGCT	X: 75,000,020		probably benign	Het
Gne	G	T	4: 44,060,045	A147D	probably damaging	Het
Gpi1	A	T	7: 34,202,477	H538Q	probably damaging	Het
Itih2	T	C	2: 10,117,403	H229R	possibly damaging	Het
Kdm7a	A	G	6: 39,206,513	V41A	probably damaging	Het
Krtap28-10	GCCACA	GCCACACCCACA	1: 83,042,136		probably benign	Het
Lipa	A	T	19: 34,509,098	S141R	probably damaging	Het
Medag	G	T	5: 149,411,994	C6F	probably benign	Het
Nefh	GGGACTTGGCCTCACCTGGGGACTTGGCCTC	GGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC	11: 4,941,030		probably benign	Het
Nefh	GACTTGGCCTCACCTGGG	GACTTGGCCTCACCTGGGTACTTGGCCTCACCTGGG	11: 4,941,032		probably benign	Het
Nefh	GGCCTCT	GGCCTCTCCTGGGGACTTTGCCTCT	11: 4,941,055		probably benign	Het
Olfr1150-ps1	A	T	2: 87,846,759	I163L	probably benign	Het
Opa1	A	G	16: 29,613,966	I482M	probably damaging	Het
Pgf	T	C	12: 85,169,542		probably null	Het
Pkhd1l1	TTTT	TTTTTTTTTTTATTT	15: 44,558,505		probably benign	Het
Pou2f1	G	A	1: 165,913,231	T134I	unknown	Het
Prss52	A	G	14: 64,113,473	S236G	probably damaging	Het
Rpsa	A	G	9: 120,131,039	T223A	probably benign	Het
Shprh	A	G	10: 11,164,841	N686S	probably benign	Het
Six3	CGG	CGGTGG	17: 85,621,368		probably benign	Het
Six4	TG	T	12: 73,103,582		probably null	Het
Slc22a27	C	T	19: 7,926,584	G63S	probably benign	Het
Tmcc2	G	T	1: 132,361,018	N310K	probably damaging	Het
Tmem144	A	T	3: 79,822,654	L263Q	probably damaging	Het
Tpra1	T	C	6: 88,909,342	V101A	probably damaging	Het
Troap	T	C	15: 99,075,400	S16P	probably benign	Het
Ttn	T	C	2: 76,713,571	T33024A	probably benign	Het
Usp2	A	ACATGTGACCTGTTCTTCACTTACT	9: 44,089,130		probably benign	Het
Was	CTCCTCCT	C	X: 8,086,231		probably null	Het
Zfp672	A	G	11: 58,316,112	V461A	probably benign	Het

Other mutations in Ctsf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01631:Ctsf	APN	19	4858078	missense	probably damaging	1.00
IGL01891:Ctsf	APN	19	4856567	missense	probably damaging	0.99
IGL03291:Ctsf	APN	19	4859634	missense	probably benign	0.00
R0587:Ctsf	UTSW	19	4855738	missense	probably benign	0.35
R0831:Ctsf	UTSW	19	4859840	missense	possibly damaging	0.92
R1808:Ctsf	UTSW	19	4856534	missense	probably benign	0.00
R5652:Ctsf	UTSW	19	4858477	missense	probably damaging	1.00
R5662:Ctsf	UTSW	19	4856578	missense	probably damaging	0.98
R6993:Ctsf	UTSW	19	4858483	missense	probably benign	0.45
R7702:Ctsf	UTSW	19	4856539	missense	probably damaging	1.00
R7703:Ctsf	UTSW	19	4856539	missense	probably damaging	1.00
R7704:Ctsf	UTSW	19	4856539	missense	probably damaging	1.00
R7705:Ctsf	UTSW	19	4856539	missense	probably damaging	1.00
R7962:Ctsf	UTSW	19	4856539	missense	probably damaging	1.00
R7965:Ctsf	UTSW	19	4856539	missense	probably damaging	1.00
R7966:Ctsf	UTSW	19	4856539	missense	probably damaging	1.00
Z1176:Ctsf	UTSW	19	4856306	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTTCTGTCACAGGCAACGTG -3'
(R):5'- GGTCCTTGTCATGCATCAGAATC -3'

Sequencing Primer
(F):5'- AGGGCCAGTGGTTCCTGAAC -3'
(R):5'- ACCTCACTTGCCATTGGAGAC -3'

Posted On

2019-12-04