Incidental Mutation 'RF013:Ptprj'
ID 603311
Institutional Source Beutler Lab
Gene Symbol Ptprj
Ensembl Gene ENSMUSG00000025314
Gene Name protein tyrosine phosphatase receptor type J
Synonyms Byp, RPTPJ, Scc1, CD148, DEP-1, Scc-1
Accession Numbers
Essential gene? Probably non essential (E-score: 0.223) question?
Stock # RF013 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 90260098-90410939 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 90301514 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 206 (L206*)
Ref Sequence ENSEMBL: ENSMUSP00000129592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111493] [ENSMUST00000111495] [ENSMUST00000168621]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000111493
AA Change: L20*
SMART Domains Protein: ENSMUSP00000107119
Gene: ENSMUSG00000025314
AA Change: L20*

DomainStartEndE-ValueType
low complexity region 34 46 N/A INTRINSIC
FN3 47 182 3.76e-6 SMART
FN3 194 271 4.56e-5 SMART
FN3 282 357 5.32e-6 SMART
FN3 368 446 2.19e-7 SMART
FN3 455 531 5e-2 SMART
FN3 546 628 2.77e1 SMART
low complexity region 637 650 N/A INTRINSIC
Blast:PTPc 714 797 8e-26 BLAST
PTPc 867 1127 3.37e-133 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111495
AA Change: L113*
SMART Domains Protein: ENSMUSP00000107121
Gene: ENSMUSG00000025314
AA Change: L113*

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
FN3 59 131 2.85e-6 SMART
FN3 140 275 3.76e-6 SMART
FN3 287 364 4.56e-5 SMART
FN3 375 450 5.32e-6 SMART
FN3 461 539 2.19e-7 SMART
FN3 548 624 5e-2 SMART
FN3 639 721 2.77e1 SMART
low complexity region 730 743 N/A INTRINSIC
Blast:PTPc 807 890 1e-25 BLAST
PTPc 960 1220 3.37e-133 SMART
Predicted Effect probably null
Transcript: ENSMUST00000168621
AA Change: L206*
SMART Domains Protein: ENSMUSP00000129592
Gene: ENSMUSG00000025314
AA Change: L206*

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 26 94 N/A INTRINSIC
low complexity region 133 140 N/A INTRINSIC
FN3 152 224 2.85e-6 SMART
FN3 233 368 3.76e-6 SMART
FN3 380 457 4.56e-5 SMART
FN3 468 543 5.32e-6 SMART
FN3 554 632 2.19e-7 SMART
FN3 641 717 5e-2 SMART
FN3 732 814 2.77e1 SMART
low complexity region 823 836 N/A INTRINSIC
Blast:PTPc 900 983 1e-25 BLAST
PTPc 1053 1313 3.37e-133 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes, including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region containing five fibronectin type III repeats, a single transmembrane region, and a single intracytoplasmic catalytic domain, and thus represents a receptor-type PTP. This protein is present in all hematopoietic lineages, and was shown to negatively regulate T cell receptor signaling possibly through interfering with the phosphorylation of Phospholipase C Gamma 1 and Linker for Activation of T Cells. This protein can also dephosphorylate the PDGF beta receptor, and may be involved in UV-induced signal transduction. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele die in utero displaying severe growth retardation and cardiovascular defects. Homozygotes for a second null allele are viable, fertile and healthy with no spontaneous tumor formation. Homozygotes for a third null allele show sterility and a block B cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,989,553 (GRCm39) probably benign Het
Adamts9 A G 6: 92,920,126 (GRCm39) V4A possibly damaging Het
AI837181 GGC GGCTGC 19: 5,475,260 (GRCm39) probably benign Het
Alk A G 17: 72,202,931 (GRCm39) Y1135H probably damaging Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,693,979 (GRCm39) probably benign Het
Ano3 A C 2: 110,527,381 (GRCm39) L609R probably benign Het
Bicc1 A G 10: 70,771,660 (GRCm39) probably null Het
Bltp1 TTAT TTATTATTATTATTAGTAT 3: 37,104,906 (GRCm39) probably benign Het
Card6 T C 15: 5,129,624 (GRCm39) I591V probably benign Het
Ccdc121rt2 T A 5: 112,597,937 (GRCm39) N161K probably benign Het
Ccdc18 A G 5: 108,368,582 (GRCm39) N1235D probably benign Het
Cd109 TTAT TTATTTATTTATCTAT 9: 78,619,813 (GRCm39) probably benign Het
Cnpy3 CCT CCTGCT 17: 47,047,670 (GRCm39) probably benign Het
Col6a5 GCAGTC GCAGTCTCCAGTC 9: 105,755,796 (GRCm39) probably null Het
Cyb5r4 GACACACTGCCCAGGGA GACACACTGCCCAGGGATGTGACACACACACTGCCCAGGGA 9: 86,922,485 (GRCm39) probably benign Het
Cyp8b1 A T 9: 121,744,561 (GRCm39) M257K possibly damaging Het
Dbf4 A T 5: 8,447,985 (GRCm39) H408Q possibly damaging Het
Defb22 TTGCGGCA TTGCGGCAGAGCTGGCCTGTGCGGCA 2: 152,327,751 (GRCm39) probably benign Het
Ercc6l2 A T 13: 64,000,831 (GRCm39) T417S probably benign Het
Exd2 AGCCACAG A 12: 80,522,706 (GRCm39) probably null Het
Fam171b GC GCAGCATC 2: 83,643,239 (GRCm39) probably benign Het
Flvcr2 T A 12: 85,793,960 (GRCm39) L112Q probably damaging Het
Flywch1 GTG GTGGGGGGAGGCTACGTACTCACCCACTCCTTTTG 17: 23,981,149 (GRCm39) probably null Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 71,314,022 (GRCm39) probably benign Het
Garin5a CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGACGGCTGGATCCTGGATCACTGGGTCTGAGGGAGGA 7: 44,149,944 (GRCm39) probably null Het
Gm4884 C A 7: 40,690,233 (GRCm39) P43Q probably damaging Het
Grm8 A G 6: 27,363,779 (GRCm39) W579R probably damaging Het
Hsdl2 AG AGCAGCAGCCACAGCTGCCG 4: 59,610,657 (GRCm39) probably benign Het
Ivl CTGCTGCTGCTGCTGT C 3: 92,479,650 (GRCm39) probably benign Het
Kif18b T C 11: 102,803,192 (GRCm39) D506G probably benign Het
Krtap28-10 AGCCAC AGCCACGGCCAC 1: 83,019,856 (GRCm39) probably benign Het
Krtap28-10 GCCACAGCCACCACA GCCACAGCCACCACATCCACAGCCACCACA 1: 83,019,995 (GRCm39) probably benign Het
Lama1 C A 17: 68,088,057 (GRCm39) S1558R Het
Lcmt1 C CCGCGGGGCTT 7: 122,969,059 (GRCm39) probably null Het
Lmna A G 3: 88,391,361 (GRCm39) V494A probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,295,542 (GRCm39) probably null Het
Mboat7 T A 7: 3,694,856 (GRCm39) H52L probably damaging Het
Med12l CAG CAGAAG 3: 59,183,387 (GRCm39) probably benign Het
Morc2a T A 11: 3,626,191 (GRCm39) M225K probably benign Het
Mpdz G A 4: 81,211,829 (GRCm39) A1566V possibly damaging Het
Mpi T C 9: 57,455,924 (GRCm39) D186G probably benign Het
Mtmr12 C A 15: 12,261,984 (GRCm39) N386K probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 66,977,182 (GRCm39) probably null Het
Myo10 T A 15: 25,799,565 (GRCm39) M1376K probably damaging Het
Nbas C T 12: 13,329,409 (GRCm39) T118I possibly damaging Het
Nedd4l C T 18: 65,342,751 (GRCm39) R755C probably damaging Het
Nefh GACTTGGCCTCACCTGGG GACTTGGCCTCACCTGGGTACTTGGCCTCACCTGGG 11: 4,891,032 (GRCm39) probably benign Het
Numa1 T C 7: 101,648,987 (GRCm39) L906P probably damaging Het
Or6s1 G A 14: 51,308,469 (GRCm39) A127V probably damaging Het
Or7h8 T C 9: 20,124,190 (GRCm39) S182P probably benign Het
Otop2 G T 11: 115,214,492 (GRCm39) R83L probably benign Het
Pmm1 T A 15: 81,842,014 (GRCm39) Q62L probably damaging Het
Pramel16 C G 4: 143,675,478 (GRCm39) Q449H probably damaging Het
Rassf6 TC TCTGCCTCACTCATGGTCCTGTAGAGCATTGGGGATCC 5: 90,756,800 (GRCm39) probably benign Het
Rps19 A AGAAAAT 7: 24,588,605 (GRCm39) probably benign Het
Rsrp1 T A 4: 134,651,266 (GRCm39) V10E unknown Het
Sh2d6 C T 6: 72,493,371 (GRCm39) probably null Het
Six4 TG T 12: 73,150,356 (GRCm39) probably null Het
Slc6a15 T A 10: 103,236,077 (GRCm39) V264D probably damaging Het
Snapc5 ATGGAAGAAGAGG A 9: 64,089,493 (GRCm39) probably benign Het
Sost A T 11: 101,854,958 (GRCm39) I117N probably damaging Het
Spmip5 A G 19: 58,777,726 (GRCm39) F28S probably damaging Het
Tbc1d22a AGGTGTGTG A 15: 86,183,975 (GRCm39) probably null Het
Tcaf1 C T 6: 42,656,107 (GRCm39) V290I probably benign Het
Tcof1 GCA GCACCA 18: 60,968,815 (GRCm39) probably benign Het
Tex55 T C 16: 38,648,363 (GRCm39) T249A probably benign Het
Tgfbr1 A G 4: 47,353,354 (GRCm39) I15V unknown Het
Tmem241 A T 18: 12,116,618 (GRCm39) L288Q probably damaging Het
Tnfrsf13b T G 11: 61,032,270 (GRCm39) V100G probably benign Het
Trim66 A G 7: 109,059,960 (GRCm39) S809P probably damaging Het
Tubb4a C G 17: 57,394,464 (GRCm39) G17A possibly damaging Het
Txndc16 A G 14: 45,406,795 (GRCm39) V220A probably benign Het
Zan T A 5: 137,389,982 (GRCm39) Q4830L unknown Het
Other mutations in Ptprj
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01528:Ptprj APN 2 90,282,488 (GRCm39) missense probably damaging 1.00
IGL01594:Ptprj APN 2 90,271,139 (GRCm39) splice site probably benign
IGL01767:Ptprj APN 2 90,299,918 (GRCm39) missense probably benign 0.11
IGL01917:Ptprj APN 2 90,300,093 (GRCm39) missense probably damaging 1.00
IGL01981:Ptprj APN 2 90,270,256 (GRCm39) missense probably damaging 1.00
IGL02830:Ptprj APN 2 90,283,488 (GRCm39) missense probably benign 0.22
IGL02955:Ptprj APN 2 90,298,808 (GRCm39) critical splice acceptor site probably null
IGL03102:Ptprj APN 2 90,309,312 (GRCm39) missense probably benign 0.02
IGL03150:Ptprj APN 2 90,290,955 (GRCm39) missense probably damaging 0.98
IGL03210:Ptprj APN 2 90,300,070 (GRCm39) missense probably benign 0.01
IGL02799:Ptprj UTSW 2 90,299,942 (GRCm39) missense probably benign 0.00
R0083:Ptprj UTSW 2 90,300,121 (GRCm39) splice site probably null
R0108:Ptprj UTSW 2 90,300,121 (GRCm39) splice site probably null
R0579:Ptprj UTSW 2 90,266,913 (GRCm39) critical splice acceptor site probably null
R1130:Ptprj UTSW 2 90,283,765 (GRCm39) missense probably damaging 1.00
R1160:Ptprj UTSW 2 90,274,868 (GRCm39) missense probably damaging 1.00
R1238:Ptprj UTSW 2 90,274,758 (GRCm39) splice site probably null
R1507:Ptprj UTSW 2 90,301,631 (GRCm39) missense possibly damaging 0.87
R1552:Ptprj UTSW 2 90,301,497 (GRCm39) missense probably damaging 0.98
R1607:Ptprj UTSW 2 90,293,664 (GRCm39) missense probably benign 0.14
R1693:Ptprj UTSW 2 90,280,141 (GRCm39) nonsense probably null
R2016:Ptprj UTSW 2 90,294,958 (GRCm39) missense probably damaging 1.00
R2017:Ptprj UTSW 2 90,294,958 (GRCm39) missense probably damaging 1.00
R2044:Ptprj UTSW 2 90,293,439 (GRCm39) missense probably damaging 0.96
R2322:Ptprj UTSW 2 90,301,473 (GRCm39) missense probably benign 0.06
R2516:Ptprj UTSW 2 90,305,340 (GRCm39) splice site probably benign
R3106:Ptprj UTSW 2 90,270,975 (GRCm39) missense probably damaging 1.00
R3964:Ptprj UTSW 2 90,298,785 (GRCm39) missense probably benign 0.00
R4201:Ptprj UTSW 2 90,293,439 (GRCm39) missense probably damaging 0.99
R4533:Ptprj UTSW 2 90,270,299 (GRCm39) missense probably damaging 1.00
R4680:Ptprj UTSW 2 90,290,840 (GRCm39) missense probably benign 0.00
R4738:Ptprj UTSW 2 90,270,987 (GRCm39) missense probably damaging 1.00
R4983:Ptprj UTSW 2 90,290,876 (GRCm39) missense probably damaging 0.98
R5137:Ptprj UTSW 2 90,299,992 (GRCm39) missense possibly damaging 0.70
R5349:Ptprj UTSW 2 90,301,605 (GRCm39) missense probably benign 0.00
R5369:Ptprj UTSW 2 90,299,985 (GRCm39) missense probably benign 0.09
R5718:Ptprj UTSW 2 90,288,613 (GRCm39) missense probably benign 0.00
R5914:Ptprj UTSW 2 90,283,684 (GRCm39) missense possibly damaging 0.81
R6022:Ptprj UTSW 2 90,301,667 (GRCm39) missense probably benign 0.14
R6341:Ptprj UTSW 2 90,288,693 (GRCm39) missense probably benign
R6421:Ptprj UTSW 2 90,301,484 (GRCm39) missense possibly damaging 0.62
R6724:Ptprj UTSW 2 90,281,195 (GRCm39) missense probably benign 0.04
R6831:Ptprj UTSW 2 90,290,991 (GRCm39) missense probably damaging 1.00
R6939:Ptprj UTSW 2 90,289,858 (GRCm39) missense possibly damaging 0.68
R6972:Ptprj UTSW 2 90,410,747 (GRCm39) missense possibly damaging 0.91
R7134:Ptprj UTSW 2 90,294,822 (GRCm39) missense probably benign 0.16
R7149:Ptprj UTSW 2 90,274,790 (GRCm39) missense possibly damaging 0.95
R7243:Ptprj UTSW 2 90,276,765 (GRCm39) missense probably damaging 0.96
R7335:Ptprj UTSW 2 90,271,126 (GRCm39) missense probably benign 0.01
R7439:Ptprj UTSW 2 90,280,163 (GRCm39) missense possibly damaging 0.82
R7441:Ptprj UTSW 2 90,280,163 (GRCm39) missense possibly damaging 0.82
R7498:Ptprj UTSW 2 90,266,909 (GRCm39) nonsense probably null
R7571:Ptprj UTSW 2 90,285,530 (GRCm39) missense probably benign 0.24
R7657:Ptprj UTSW 2 90,282,501 (GRCm39) splice site probably null
R7672:Ptprj UTSW 2 90,290,940 (GRCm39) missense possibly damaging 0.49
R7849:Ptprj UTSW 2 90,274,804 (GRCm39) missense probably damaging 0.98
R7939:Ptprj UTSW 2 90,295,009 (GRCm39) missense probably damaging 1.00
R7958:Ptprj UTSW 2 90,299,971 (GRCm39) missense possibly damaging 0.71
R8338:Ptprj UTSW 2 90,301,481 (GRCm39) missense possibly damaging 0.48
R8354:Ptprj UTSW 2 90,300,061 (GRCm39) missense probably benign 0.43
R8556:Ptprj UTSW 2 90,271,044 (GRCm39) missense probably damaging 1.00
R8695:Ptprj UTSW 2 90,301,481 (GRCm39) missense possibly damaging 0.48
R8784:Ptprj UTSW 2 90,290,856 (GRCm39) missense possibly damaging 0.49
R8984:Ptprj UTSW 2 90,270,987 (GRCm39) missense probably damaging 1.00
R9054:Ptprj UTSW 2 90,290,984 (GRCm39) missense probably damaging 1.00
R9056:Ptprj UTSW 2 90,288,613 (GRCm39) missense probably benign 0.00
R9147:Ptprj UTSW 2 90,288,562 (GRCm39) missense probably benign 0.02
R9148:Ptprj UTSW 2 90,288,562 (GRCm39) missense probably benign 0.02
R9168:Ptprj UTSW 2 90,294,916 (GRCm39) missense possibly damaging 0.62
R9314:Ptprj UTSW 2 90,301,631 (GRCm39) missense possibly damaging 0.87
R9337:Ptprj UTSW 2 90,270,238 (GRCm39) missense probably damaging 1.00
R9546:Ptprj UTSW 2 90,274,805 (GRCm39) missense probably benign 0.08
Z1177:Ptprj UTSW 2 90,290,913 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GATATGATCTTTTCCATGAGTCCTGC -3'
(R):5'- AACGCACATTCATGCACAGG -3'

Sequencing Primer
(F):5'- TCCATGAGTCCTGCCCTGAG -3'
(R):5'- GTCCCAACAAGGTAGACTTTATTC -3'
Posted On 2019-12-04