Incidental Mutation 'RF013:Ano3'
ID603312
Institutional Source Beutler Lab
Gene Symbol Ano3
Ensembl Gene ENSMUSG00000074968
Gene Nameanoctamin 3
SynonymsTmem16c, B230324K02Rik
Accession Numbers

Genbank: NM_001081556, NM_001128103; MGI: 3613666

Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #RF013 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location110655201-110950923 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 110697036 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 609 (L609R)
Ref Sequence ENSEMBL: ENSMUSP00000097219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099623]
Predicted Effect probably benign
Transcript: ENSMUST00000099623
AA Change: L609R

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097219
Gene: ENSMUSG00000074968
AA Change: L609R

DomainStartEndE-ValueType
Pfam:Anoct_dimer 156 381 2.9e-70 PFAM
Pfam:Anoctamin 384 950 4.4e-138 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the TMEM16 family of predicted membrane proteins, that are also known as anoctamins. While little is known about the function of this gene, mutations in this gene have been associated with some cases of autosomal dominant craniocervical dystonia. Cells from individuals with a mutation in this gene exhibited abnormalities in endoplasmic reticulum-dependent calcium signaling. Studies in rat show that the rat ortholog of this protein interacts with, and modulates the activity of a sodium-activated potassium channel. Deletion of this gene caused increased pain sensitivity in the rat model system. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A G 19: 58,789,294 F28S probably damaging Het
4930435E12Rik T C 16: 38,828,001 T249A probably benign Het
4932438A13Rik TTAT TTATTATTATTATTAGTAT 3: 37,050,757 probably benign Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,905,096 probably benign Het
Adamts9 A G 6: 92,943,145 V4A possibly damaging Het
AI837181 GGC GGCTGC 19: 5,425,232 probably benign Het
Alk A G 17: 71,895,936 Y1135H probably damaging Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,560,926 probably benign Het
Bicc1 A G 10: 70,935,830 probably null Het
Card6 T C 15: 5,100,142 I591V probably benign Het
Ccdc18 A G 5: 108,220,716 N1235D probably benign Het
Cd109 TTAT TTATTTATTTATCTAT 9: 78,712,531 probably benign Het
Cnpy3 CCT CCTGCT 17: 46,736,744 probably benign Het
Col6a5 GCAGTC GCAGTCTCCAGTC 9: 105,878,597 probably null Het
Cyb5r4 GACACACTGCCCAGGGA GACACACTGCCCAGGGATGTGACACACACACTGCCCAGGGA 9: 87,040,432 probably benign Het
Cyp8b1 A T 9: 121,915,495 M257K possibly damaging Het
Dbf4 A T 5: 8,397,985 H408Q possibly damaging Het
Defb22 TTGCGGCA TTGCGGCAGAGCTGGCCTGTGCGGCA 2: 152,485,831 probably benign Het
Ercc6l2 A T 13: 63,853,017 T417S probably benign Het
Exd2 AGCCACAG A 12: 80,475,932 probably null Het
Fam171b GC GCAGCATC 2: 83,812,895 probably benign Het
Fam71e1 CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGACGGCTGGATCCTGGATCACTGGGTCTGAGGGAGGA 7: 44,500,520 probably null Het
Flvcr2 T A 12: 85,747,186 L112Q probably damaging Het
Flywch1 GTG GTGGGGGGAGGCTACGTACTCACCCACTCCTTTTG 17: 23,762,175 probably null Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 72,270,416 probably benign Het
Gm4884 C A 7: 41,040,809 P43Q probably damaging Het
Gm6588 T A 5: 112,450,071 N161K probably benign Het
Grm8 A G 6: 27,363,780 W579R probably damaging Het
Hsdl2 AG AGCAGCAGCCACAGCTGCCG 4: 59,610,657 probably benign Het
Ivl CTGCTGCTGCTGCTGT C 3: 92,572,343 probably benign Het
Kif18b T C 11: 102,912,366 D506G probably benign Het
Krtap28-10 AGCCAC AGCCACGGCCAC 1: 83,042,135 probably benign Het
Krtap28-10 GCCACAGCCACCACA GCCACAGCCACCACATCCACAGCCACCACA 1: 83,042,274 probably benign Het
Lama1 C A 17: 67,781,062 S1558R Het
Lcmt1 C CCGCGGGGCTT 7: 123,369,836 probably null Het
Lmna A G 3: 88,484,054 V494A probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,388,260 probably null Het
Mboat7 T A 7: 3,691,857 H52L probably damaging Het
Med12l CAG CAGAAG 3: 59,275,966 probably benign Het
Morc2a T A 11: 3,676,191 M225K probably benign Het
Mpdz G A 4: 81,293,592 A1566V possibly damaging Het
Mpi T C 9: 57,548,641 D186G probably benign Het
Mtmr12 C A 15: 12,261,898 N386K probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myo10 T A 15: 25,799,479 M1376K probably damaging Het
Nbas C T 12: 13,279,408 T118I possibly damaging Het
Nedd4l C T 18: 65,209,680 R755C probably damaging Het
Nefh GACTTGGCCTCACCTGGG GACTTGGCCTCACCTGGGTACTTGGCCTCACCTGGG 11: 4,941,032 probably benign Het
Numa1 T C 7: 101,999,780 L906P probably damaging Het
Olfr750 G A 14: 51,071,012 A127V probably damaging Het
Olfr871 T C 9: 20,212,894 S182P probably benign Het
Otop2 G T 11: 115,323,666 R83L probably benign Het
Pmm1 T A 15: 81,957,813 Q62L probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Ptprj A T 2: 90,471,170 L206* probably null Het
Rassf6 TC TCTGCCTCACTCATGGTCCTGTAGAGCATTGGGGATCC 5: 90,608,941 probably benign Het
Rps19 A AGAAAAT 7: 24,889,180 probably benign Het
Rsrp1 T A 4: 134,923,955 V10E unknown Het
Sh2d6 C T 6: 72,516,388 probably null Het
Six4 TG T 12: 73,103,582 probably null Het
Slc6a15 T A 10: 103,400,216 V264D probably damaging Het
Snapc5 ATGGAAGAAGAGG A 9: 64,182,211 probably benign Het
Sost A T 11: 101,964,132 I117N probably damaging Het
Tbc1d22a AGGTGTGTG A 15: 86,299,774 probably null Het
Tcaf1 C T 6: 42,679,173 V290I probably benign Het
Tcof1 GCA GCACCA 18: 60,835,743 probably benign Het
Tgfbr1 A G 4: 47,353,354 I15V unknown Het
Tmem241 A T 18: 11,983,561 L288Q probably damaging Het
Tnfrsf13b T G 11: 61,141,444 V100G probably benign Het
Trim66 A G 7: 109,460,753 S809P probably damaging Het
Tubb4a C G 17: 57,087,464 G17A possibly damaging Het
Txndc16 A G 14: 45,169,338 V220A probably benign Het
Zan T A 5: 137,391,720 Q4830L unknown Het
Other mutations in Ano3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ano3 APN 2 110771050 splice site probably benign
IGL01066:Ano3 APN 2 110661445 missense probably null 0.00
IGL01696:Ano3 APN 2 110667737 missense probably damaging 1.00
IGL01729:Ano3 APN 2 110781394 splice site probably null
IGL01785:Ano3 APN 2 110682715 missense probably damaging 1.00
IGL01786:Ano3 APN 2 110682715 missense probably damaging 1.00
IGL01992:Ano3 APN 2 110658219 missense probably damaging 1.00
IGL02098:Ano3 APN 2 110666441 nonsense probably null
IGL02333:Ano3 APN 2 110697199 splice site probably benign
IGL02346:Ano3 APN 2 110770926 splice site probably benign
IGL02352:Ano3 APN 2 110884943 nonsense probably null
IGL02359:Ano3 APN 2 110884943 nonsense probably null
IGL02544:Ano3 APN 2 110658249 missense possibly damaging 0.79
IGL02750:Ano3 APN 2 110665984 splice site probably benign
IGL02861:Ano3 APN 2 110738812 missense probably damaging 1.00
IGL02948:Ano3 APN 2 110697018 splice site probably benign
IGL03327:Ano3 APN 2 110697178 missense possibly damaging 0.62
3-1:Ano3 UTSW 2 110697124 missense probably damaging 1.00
IGL02988:Ano3 UTSW 2 110775010 missense probably damaging 1.00
IGL03147:Ano3 UTSW 2 110697418 missense probably damaging 1.00
R0349:Ano3 UTSW 2 110661487 missense probably damaging 1.00
R0426:Ano3 UTSW 2 110661174 missense probably damaging 1.00
R0523:Ano3 UTSW 2 110884855 missense probably benign 0.13
R0557:Ano3 UTSW 2 110862952 splice site probably null
R0611:Ano3 UTSW 2 110885001 missense possibly damaging 0.93
R0891:Ano3 UTSW 2 110697976 missense probably benign 0.03
R1459:Ano3 UTSW 2 110880829 missense probably benign 0.00
R1460:Ano3 UTSW 2 110682758 missense probably damaging 0.97
R1773:Ano3 UTSW 2 110761455 missense probably damaging 1.00
R1874:Ano3 UTSW 2 110884872 missense probably benign 0.00
R1919:Ano3 UTSW 2 110885007 missense probably benign
R2185:Ano3 UTSW 2 110775045 missense probably benign 0.01
R2280:Ano3 UTSW 2 110682759 missense probably benign 0.22
R2281:Ano3 UTSW 2 110682759 missense probably benign 0.22
R2348:Ano3 UTSW 2 110783743 missense possibly damaging 0.82
R2425:Ano3 UTSW 2 110862843 missense probably benign
R2697:Ano3 UTSW 2 110794960 missense possibly damaging 0.79
R3888:Ano3 UTSW 2 110885000 missense probably damaging 0.99
R3923:Ano3 UTSW 2 110770959 missense probably damaging 1.00
R4352:Ano3 UTSW 2 110745894 missense possibly damaging 0.74
R4447:Ano3 UTSW 2 110761578 splice site probably null
R4790:Ano3 UTSW 2 110884919 missense probably benign
R4832:Ano3 UTSW 2 110667722 missense probably damaging 1.00
R4916:Ano3 UTSW 2 110771020 missense possibly damaging 0.74
R5113:Ano3 UTSW 2 110661480 missense possibly damaging 0.61
R5486:Ano3 UTSW 2 110745870 missense probably damaging 1.00
R5498:Ano3 UTSW 2 110697103 missense possibly damaging 0.68
R5589:Ano3 UTSW 2 110884995 missense probably damaging 0.99
R5627:Ano3 UTSW 2 110756953 missense possibly damaging 0.61
R5741:Ano3 UTSW 2 110658273 missense probably benign 0.11
R5767:Ano3 UTSW 2 110661271 missense probably damaging 1.00
R5883:Ano3 UTSW 2 110880864 missense probably null 0.15
R5899:Ano3 UTSW 2 110862887 missense probably benign 0.39
R5916:Ano3 UTSW 2 110681836 missense probably benign 0.29
R6158:Ano3 UTSW 2 110665875 missense probably damaging 1.00
R6315:Ano3 UTSW 2 110697039 missense probably damaging 1.00
R6401:Ano3 UTSW 2 110775114 missense probably benign 0.01
R6481:Ano3 UTSW 2 110795027 missense probably benign 0.16
R6482:Ano3 UTSW 2 110697055 missense probably damaging 1.00
R6587:Ano3 UTSW 2 110797904 splice site probably null
R6811:Ano3 UTSW 2 110880867 missense probably benign 0.03
R7048:Ano3 UTSW 2 110682771 nonsense probably null
R7145:Ano3 UTSW 2 110862860 missense probably benign 0.31
R7207:Ano3 UTSW 2 110781423 missense probably damaging 0.96
R7215:Ano3 UTSW 2 110665932 missense probably damaging 1.00
R7366:Ano3 UTSW 2 110757067 missense probably damaging 1.00
R7371:Ano3 UTSW 2 110884849 critical splice donor site probably null
R7568:Ano3 UTSW 2 110950293 start gained probably benign
R7636:Ano3 UTSW 2 110682703 nonsense probably null
R7888:Ano3 UTSW 2 110666428 missense probably damaging 1.00
R7992:Ano3 UTSW 2 110775022 missense possibly damaging 0.77
R8024:Ano3 UTSW 2 110667783 missense probably damaging 0.99
R8074:Ano3 UTSW 2 110950232 start gained probably benign
R8111:Ano3 UTSW 2 110783713 missense possibly damaging 0.95
R8177:Ano3 UTSW 2 110666456 missense probably damaging 1.00
R8297:Ano3 UTSW 2 110661271 missense probably damaging 1.00
R8509:Ano3 UTSW 2 110665835 missense possibly damaging 0.50
RF012:Ano3 UTSW 2 110697523 missense possibly damaging 0.83
X0058:Ano3 UTSW 2 110697418 missense probably damaging 1.00
Z1088:Ano3 UTSW 2 110745847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGTGCATAAAACAAGCTGG -3'
(R):5'- GGATATTCTAGCACACCAAGAATAC -3'

Sequencing Primer
(F):5'- AACAAGCTGGATGAAATACTGC -3'
(R):5'- GTAACACAAAAGGCCTGTTTGC -3'
Posted On2019-12-04