Incidental Mutation 'RF013:Ano3'
ID 603312
Institutional Source Beutler Lab
Gene Symbol Ano3
Ensembl Gene ENSMUSG00000074968
Gene Name anoctamin 3
Synonyms B230324K02Rik, Tmem16c
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # RF013 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 110485546-110780854 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 110527381 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 609 (L609R)
Ref Sequence ENSEMBL: ENSMUSP00000097219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099623]
AlphaFold A2AHL1
Predicted Effect probably benign
Transcript: ENSMUST00000099623
AA Change: L609R

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097219
Gene: ENSMUSG00000074968
AA Change: L609R

DomainStartEndE-ValueType
Pfam:Anoct_dimer 156 381 2.9e-70 PFAM
Pfam:Anoctamin 384 950 4.4e-138 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the TMEM16 family of predicted membrane proteins, that are also known as anoctamins. While little is known about the function of this gene, mutations in this gene have been associated with some cases of autosomal dominant craniocervical dystonia. Cells from individuals with a mutation in this gene exhibited abnormalities in endoplasmic reticulum-dependent calcium signaling. Studies in rat show that the rat ortholog of this protein interacts with, and modulates the activity of a sodium-activated potassium channel. Deletion of this gene caused increased pain sensitivity in the rat model system. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,989,553 (GRCm39) probably benign Het
Adamts9 A G 6: 92,920,126 (GRCm39) V4A possibly damaging Het
AI837181 GGC GGCTGC 19: 5,475,260 (GRCm39) probably benign Het
Alk A G 17: 72,202,931 (GRCm39) Y1135H probably damaging Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,693,979 (GRCm39) probably benign Het
Bicc1 A G 10: 70,771,660 (GRCm39) probably null Het
Bltp1 TTAT TTATTATTATTATTAGTAT 3: 37,104,906 (GRCm39) probably benign Het
Card6 T C 15: 5,129,624 (GRCm39) I591V probably benign Het
Ccdc121rt2 T A 5: 112,597,937 (GRCm39) N161K probably benign Het
Ccdc18 A G 5: 108,368,582 (GRCm39) N1235D probably benign Het
Cd109 TTAT TTATTTATTTATCTAT 9: 78,619,813 (GRCm39) probably benign Het
Cnpy3 CCT CCTGCT 17: 47,047,670 (GRCm39) probably benign Het
Col6a5 GCAGTC GCAGTCTCCAGTC 9: 105,755,796 (GRCm39) probably null Het
Cyb5r4 GACACACTGCCCAGGGA GACACACTGCCCAGGGATGTGACACACACACTGCCCAGGGA 9: 86,922,485 (GRCm39) probably benign Het
Cyp8b1 A T 9: 121,744,561 (GRCm39) M257K possibly damaging Het
Dbf4 A T 5: 8,447,985 (GRCm39) H408Q possibly damaging Het
Defb22 TTGCGGCA TTGCGGCAGAGCTGGCCTGTGCGGCA 2: 152,327,751 (GRCm39) probably benign Het
Ercc6l2 A T 13: 64,000,831 (GRCm39) T417S probably benign Het
Exd2 AGCCACAG A 12: 80,522,706 (GRCm39) probably null Het
Fam171b GC GCAGCATC 2: 83,643,239 (GRCm39) probably benign Het
Flvcr2 T A 12: 85,793,960 (GRCm39) L112Q probably damaging Het
Flywch1 GTG GTGGGGGGAGGCTACGTACTCACCCACTCCTTTTG 17: 23,981,149 (GRCm39) probably null Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 71,314,022 (GRCm39) probably benign Het
Garin5a CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGACGGCTGGATCCTGGATCACTGGGTCTGAGGGAGGA 7: 44,149,944 (GRCm39) probably null Het
Gm4884 C A 7: 40,690,233 (GRCm39) P43Q probably damaging Het
Grm8 A G 6: 27,363,779 (GRCm39) W579R probably damaging Het
Hsdl2 AG AGCAGCAGCCACAGCTGCCG 4: 59,610,657 (GRCm39) probably benign Het
Ivl CTGCTGCTGCTGCTGT C 3: 92,479,650 (GRCm39) probably benign Het
Kif18b T C 11: 102,803,192 (GRCm39) D506G probably benign Het
Krtap28-10 AGCCAC AGCCACGGCCAC 1: 83,019,856 (GRCm39) probably benign Het
Krtap28-10 GCCACAGCCACCACA GCCACAGCCACCACATCCACAGCCACCACA 1: 83,019,995 (GRCm39) probably benign Het
Lama1 C A 17: 68,088,057 (GRCm39) S1558R Het
Lcmt1 C CCGCGGGGCTT 7: 122,969,059 (GRCm39) probably null Het
Lmna A G 3: 88,391,361 (GRCm39) V494A probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,295,542 (GRCm39) probably null Het
Mboat7 T A 7: 3,694,856 (GRCm39) H52L probably damaging Het
Med12l CAG CAGAAG 3: 59,183,387 (GRCm39) probably benign Het
Morc2a T A 11: 3,626,191 (GRCm39) M225K probably benign Het
Mpdz G A 4: 81,211,829 (GRCm39) A1566V possibly damaging Het
Mpi T C 9: 57,455,924 (GRCm39) D186G probably benign Het
Mtmr12 C A 15: 12,261,984 (GRCm39) N386K probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 66,977,182 (GRCm39) probably null Het
Myo10 T A 15: 25,799,565 (GRCm39) M1376K probably damaging Het
Nbas C T 12: 13,329,409 (GRCm39) T118I possibly damaging Het
Nedd4l C T 18: 65,342,751 (GRCm39) R755C probably damaging Het
Nefh GACTTGGCCTCACCTGGG GACTTGGCCTCACCTGGGTACTTGGCCTCACCTGGG 11: 4,891,032 (GRCm39) probably benign Het
Numa1 T C 7: 101,648,987 (GRCm39) L906P probably damaging Het
Or6s1 G A 14: 51,308,469 (GRCm39) A127V probably damaging Het
Or7h8 T C 9: 20,124,190 (GRCm39) S182P probably benign Het
Otop2 G T 11: 115,214,492 (GRCm39) R83L probably benign Het
Pmm1 T A 15: 81,842,014 (GRCm39) Q62L probably damaging Het
Pramel16 C G 4: 143,675,478 (GRCm39) Q449H probably damaging Het
Ptprj A T 2: 90,301,514 (GRCm39) L206* probably null Het
Rassf6 TC TCTGCCTCACTCATGGTCCTGTAGAGCATTGGGGATCC 5: 90,756,800 (GRCm39) probably benign Het
Rps19 A AGAAAAT 7: 24,588,605 (GRCm39) probably benign Het
Rsrp1 T A 4: 134,651,266 (GRCm39) V10E unknown Het
Sh2d6 C T 6: 72,493,371 (GRCm39) probably null Het
Six4 TG T 12: 73,150,356 (GRCm39) probably null Het
Slc6a15 T A 10: 103,236,077 (GRCm39) V264D probably damaging Het
Snapc5 ATGGAAGAAGAGG A 9: 64,089,493 (GRCm39) probably benign Het
Sost A T 11: 101,854,958 (GRCm39) I117N probably damaging Het
Spmip5 A G 19: 58,777,726 (GRCm39) F28S probably damaging Het
Tbc1d22a AGGTGTGTG A 15: 86,183,975 (GRCm39) probably null Het
Tcaf1 C T 6: 42,656,107 (GRCm39) V290I probably benign Het
Tcof1 GCA GCACCA 18: 60,968,815 (GRCm39) probably benign Het
Tex55 T C 16: 38,648,363 (GRCm39) T249A probably benign Het
Tgfbr1 A G 4: 47,353,354 (GRCm39) I15V unknown Het
Tmem241 A T 18: 12,116,618 (GRCm39) L288Q probably damaging Het
Tnfrsf13b T G 11: 61,032,270 (GRCm39) V100G probably benign Het
Trim66 A G 7: 109,059,960 (GRCm39) S809P probably damaging Het
Tubb4a C G 17: 57,394,464 (GRCm39) G17A possibly damaging Het
Txndc16 A G 14: 45,406,795 (GRCm39) V220A probably benign Het
Zan T A 5: 137,389,982 (GRCm39) Q4830L unknown Het
Other mutations in Ano3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ano3 APN 2 110,601,395 (GRCm39) splice site probably benign
IGL01066:Ano3 APN 2 110,491,790 (GRCm39) missense probably null 0.00
IGL01696:Ano3 APN 2 110,498,082 (GRCm39) missense probably damaging 1.00
IGL01729:Ano3 APN 2 110,611,739 (GRCm39) splice site probably null
IGL01785:Ano3 APN 2 110,513,060 (GRCm39) missense probably damaging 1.00
IGL01786:Ano3 APN 2 110,513,060 (GRCm39) missense probably damaging 1.00
IGL01992:Ano3 APN 2 110,488,564 (GRCm39) missense probably damaging 1.00
IGL02098:Ano3 APN 2 110,496,786 (GRCm39) nonsense probably null
IGL02333:Ano3 APN 2 110,527,544 (GRCm39) splice site probably benign
IGL02346:Ano3 APN 2 110,601,271 (GRCm39) splice site probably benign
IGL02352:Ano3 APN 2 110,715,288 (GRCm39) nonsense probably null
IGL02359:Ano3 APN 2 110,715,288 (GRCm39) nonsense probably null
IGL02544:Ano3 APN 2 110,488,594 (GRCm39) missense possibly damaging 0.79
IGL02750:Ano3 APN 2 110,496,329 (GRCm39) splice site probably benign
IGL02861:Ano3 APN 2 110,569,157 (GRCm39) missense probably damaging 1.00
IGL02948:Ano3 APN 2 110,527,363 (GRCm39) splice site probably benign
IGL03327:Ano3 APN 2 110,527,523 (GRCm39) missense possibly damaging 0.62
3-1:Ano3 UTSW 2 110,527,469 (GRCm39) missense probably damaging 1.00
IGL02988:Ano3 UTSW 2 110,605,355 (GRCm39) missense probably damaging 1.00
IGL03147:Ano3 UTSW 2 110,527,763 (GRCm39) missense probably damaging 1.00
R0349:Ano3 UTSW 2 110,491,832 (GRCm39) missense probably damaging 1.00
R0426:Ano3 UTSW 2 110,491,519 (GRCm39) missense probably damaging 1.00
R0523:Ano3 UTSW 2 110,715,200 (GRCm39) missense probably benign 0.13
R0557:Ano3 UTSW 2 110,693,297 (GRCm39) splice site probably null
R0611:Ano3 UTSW 2 110,715,346 (GRCm39) missense possibly damaging 0.93
R0891:Ano3 UTSW 2 110,528,321 (GRCm39) missense probably benign 0.03
R1459:Ano3 UTSW 2 110,711,174 (GRCm39) missense probably benign 0.00
R1460:Ano3 UTSW 2 110,513,103 (GRCm39) missense probably damaging 0.97
R1773:Ano3 UTSW 2 110,591,800 (GRCm39) missense probably damaging 1.00
R1874:Ano3 UTSW 2 110,715,217 (GRCm39) missense probably benign 0.00
R1919:Ano3 UTSW 2 110,715,352 (GRCm39) missense probably benign
R2185:Ano3 UTSW 2 110,605,390 (GRCm39) missense probably benign 0.01
R2280:Ano3 UTSW 2 110,513,104 (GRCm39) missense probably benign 0.22
R2281:Ano3 UTSW 2 110,513,104 (GRCm39) missense probably benign 0.22
R2348:Ano3 UTSW 2 110,614,088 (GRCm39) missense possibly damaging 0.82
R2425:Ano3 UTSW 2 110,693,188 (GRCm39) missense probably benign
R2697:Ano3 UTSW 2 110,625,305 (GRCm39) missense possibly damaging 0.79
R3888:Ano3 UTSW 2 110,715,345 (GRCm39) missense probably damaging 0.99
R3923:Ano3 UTSW 2 110,601,304 (GRCm39) missense probably damaging 1.00
R4352:Ano3 UTSW 2 110,576,239 (GRCm39) missense possibly damaging 0.74
R4447:Ano3 UTSW 2 110,591,923 (GRCm39) splice site probably null
R4790:Ano3 UTSW 2 110,715,264 (GRCm39) missense probably benign
R4832:Ano3 UTSW 2 110,498,067 (GRCm39) missense probably damaging 1.00
R4916:Ano3 UTSW 2 110,601,365 (GRCm39) missense possibly damaging 0.74
R5113:Ano3 UTSW 2 110,491,825 (GRCm39) missense possibly damaging 0.61
R5486:Ano3 UTSW 2 110,576,215 (GRCm39) missense probably damaging 1.00
R5498:Ano3 UTSW 2 110,527,448 (GRCm39) missense possibly damaging 0.68
R5589:Ano3 UTSW 2 110,715,340 (GRCm39) missense probably damaging 0.99
R5627:Ano3 UTSW 2 110,587,298 (GRCm39) missense possibly damaging 0.61
R5741:Ano3 UTSW 2 110,488,618 (GRCm39) missense probably benign 0.11
R5767:Ano3 UTSW 2 110,491,616 (GRCm39) missense probably damaging 1.00
R5883:Ano3 UTSW 2 110,711,209 (GRCm39) missense probably null 0.15
R5899:Ano3 UTSW 2 110,693,232 (GRCm39) missense probably benign 0.39
R5916:Ano3 UTSW 2 110,512,181 (GRCm39) missense probably benign 0.29
R6158:Ano3 UTSW 2 110,496,220 (GRCm39) missense probably damaging 1.00
R6315:Ano3 UTSW 2 110,527,384 (GRCm39) missense probably damaging 1.00
R6401:Ano3 UTSW 2 110,605,459 (GRCm39) missense probably benign 0.01
R6481:Ano3 UTSW 2 110,625,372 (GRCm39) missense probably benign 0.16
R6482:Ano3 UTSW 2 110,527,400 (GRCm39) missense probably damaging 1.00
R6587:Ano3 UTSW 2 110,628,249 (GRCm39) splice site probably null
R6811:Ano3 UTSW 2 110,711,212 (GRCm39) missense probably benign 0.03
R7048:Ano3 UTSW 2 110,513,116 (GRCm39) nonsense probably null
R7145:Ano3 UTSW 2 110,693,205 (GRCm39) missense probably benign 0.31
R7207:Ano3 UTSW 2 110,611,768 (GRCm39) missense probably damaging 0.96
R7215:Ano3 UTSW 2 110,496,277 (GRCm39) missense probably damaging 1.00
R7366:Ano3 UTSW 2 110,587,412 (GRCm39) missense probably damaging 1.00
R7371:Ano3 UTSW 2 110,715,194 (GRCm39) critical splice donor site probably null
R7568:Ano3 UTSW 2 110,780,638 (GRCm39) start gained probably benign
R7636:Ano3 UTSW 2 110,513,048 (GRCm39) nonsense probably null
R7888:Ano3 UTSW 2 110,496,773 (GRCm39) missense probably damaging 1.00
R7992:Ano3 UTSW 2 110,605,367 (GRCm39) missense possibly damaging 0.77
R8024:Ano3 UTSW 2 110,498,128 (GRCm39) missense probably damaging 0.99
R8074:Ano3 UTSW 2 110,780,577 (GRCm39) start gained probably benign
R8111:Ano3 UTSW 2 110,614,058 (GRCm39) missense possibly damaging 0.95
R8177:Ano3 UTSW 2 110,496,801 (GRCm39) missense probably damaging 1.00
R8297:Ano3 UTSW 2 110,491,616 (GRCm39) missense probably damaging 1.00
R8485:Ano3 UTSW 2 110,498,200 (GRCm39) critical splice acceptor site probably null
R8509:Ano3 UTSW 2 110,496,180 (GRCm39) missense possibly damaging 0.50
R8870:Ano3 UTSW 2 110,614,074 (GRCm39) missense probably benign 0.12
R9071:Ano3 UTSW 2 110,625,418 (GRCm39) critical splice acceptor site probably null
R9072:Ano3 UTSW 2 110,576,243 (GRCm39) missense probably benign 0.06
R9073:Ano3 UTSW 2 110,576,243 (GRCm39) missense probably benign 0.06
R9315:Ano3 UTSW 2 110,528,287 (GRCm39) missense probably damaging 0.97
R9376:Ano3 UTSW 2 110,496,782 (GRCm39) missense probably damaging 1.00
R9588:Ano3 UTSW 2 110,528,342 (GRCm39) missense possibly damaging 0.91
R9697:Ano3 UTSW 2 110,496,253 (GRCm39) missense probably damaging 1.00
R9716:Ano3 UTSW 2 110,601,376 (GRCm39) missense probably damaging 0.97
R9748:Ano3 UTSW 2 110,488,640 (GRCm39) missense probably damaging 1.00
RF012:Ano3 UTSW 2 110,527,868 (GRCm39) missense possibly damaging 0.83
X0058:Ano3 UTSW 2 110,527,763 (GRCm39) missense probably damaging 1.00
Z1088:Ano3 UTSW 2 110,576,192 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGTGCATAAAACAAGCTGG -3'
(R):5'- GGATATTCTAGCACACCAAGAATAC -3'

Sequencing Primer
(F):5'- AACAAGCTGGATGAAATACTGC -3'
(R):5'- GTAACACAAAAGGCCTGTTTGC -3'
Posted On 2019-12-04