Incidental Mutation 'RF013:Med12l'
ID 603315
Institutional Source Beutler Lab
Gene Symbol Med12l
Ensembl Gene ENSMUSG00000056476
Gene Name mediator complex subunit 12-like
Synonyms
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.257) question?
Stock # RF013 (G1)
Quality Score 197.468
Status Not validated
Chromosome 3
Chromosomal Location 58913246-59226103 bp(+) (GRCm39)
Type of Mutation small insertion (1 aa in frame mutation)
DNA Base Change (assembly) CAG to CAGAAG at 59183387 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040325] [ENSMUST00000164225] [ENSMUST00000199659]
AlphaFold Q8BQM9
Predicted Effect probably benign
Transcript: ENSMUST00000040325
SMART Domains Protein: ENSMUSP00000042269
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 730 2.6e-207 PFAM
low complexity region 744 758 N/A INTRINSIC
low complexity region 853 872 N/A INTRINSIC
low complexity region 1455 1466 N/A INTRINSIC
low complexity region 1728 1742 N/A INTRINSIC
low complexity region 1769 1783 N/A INTRINSIC
Pfam:Med12-PQL 1803 2029 2.3e-14 PFAM
low complexity region 2055 2076 N/A INTRINSIC
low complexity region 2083 2101 N/A INTRINSIC
low complexity region 2116 2136 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164225
SMART Domains Protein: ENSMUSP00000127038
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 283 765 5e-187 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1763 1777 N/A INTRINSIC
low complexity region 1804 1818 N/A INTRINSIC
Pfam:Med12-PQL 1840 2063 9.7e-66 PFAM
low complexity region 2090 2111 N/A INTRINSIC
low complexity region 2118 2136 N/A INTRINSIC
low complexity region 2151 2171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197374
Predicted Effect probably benign
Transcript: ENSMUST00000199659
SMART Domains Protein: ENSMUSP00000142903
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 765 5.5e-209 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1761 1775 N/A INTRINSIC
low complexity region 1802 1816 N/A INTRINSIC
Pfam:Med12-PQL 1836 2062 1.7e-15 PFAM
low complexity region 2088 2130 N/A INTRINSIC
low complexity region 2144 2164 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the Mediator complex, which is involved in transcriptional coactivation of nearly all RNA polymerase II-dependent genes. The Mediator complex links gene-specific transcriptional activators with the basal transcription machinery. [provided by RefSeq, May 2010]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,989,553 (GRCm39) probably benign Het
Adamts9 A G 6: 92,920,126 (GRCm39) V4A possibly damaging Het
AI837181 GGC GGCTGC 19: 5,475,260 (GRCm39) probably benign Het
Alk A G 17: 72,202,931 (GRCm39) Y1135H probably damaging Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,693,979 (GRCm39) probably benign Het
Ano3 A C 2: 110,527,381 (GRCm39) L609R probably benign Het
Bicc1 A G 10: 70,771,660 (GRCm39) probably null Het
Bltp1 TTAT TTATTATTATTATTAGTAT 3: 37,104,906 (GRCm39) probably benign Het
Card6 T C 15: 5,129,624 (GRCm39) I591V probably benign Het
Ccdc121rt2 T A 5: 112,597,937 (GRCm39) N161K probably benign Het
Ccdc18 A G 5: 108,368,582 (GRCm39) N1235D probably benign Het
Cd109 TTAT TTATTTATTTATCTAT 9: 78,619,813 (GRCm39) probably benign Het
Cnpy3 CCT CCTGCT 17: 47,047,670 (GRCm39) probably benign Het
Col6a5 GCAGTC GCAGTCTCCAGTC 9: 105,755,796 (GRCm39) probably null Het
Cyb5r4 GACACACTGCCCAGGGA GACACACTGCCCAGGGATGTGACACACACACTGCCCAGGGA 9: 86,922,485 (GRCm39) probably benign Het
Cyp8b1 A T 9: 121,744,561 (GRCm39) M257K possibly damaging Het
Dbf4 A T 5: 8,447,985 (GRCm39) H408Q possibly damaging Het
Defb22 TTGCGGCA TTGCGGCAGAGCTGGCCTGTGCGGCA 2: 152,327,751 (GRCm39) probably benign Het
Ercc6l2 A T 13: 64,000,831 (GRCm39) T417S probably benign Het
Exd2 AGCCACAG A 12: 80,522,706 (GRCm39) probably null Het
Fam171b GC GCAGCATC 2: 83,643,239 (GRCm39) probably benign Het
Flvcr2 T A 12: 85,793,960 (GRCm39) L112Q probably damaging Het
Flywch1 GTG GTGGGGGGAGGCTACGTACTCACCCACTCCTTTTG 17: 23,981,149 (GRCm39) probably null Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 71,314,022 (GRCm39) probably benign Het
Garin5a CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGACGGCTGGATCCTGGATCACTGGGTCTGAGGGAGGA 7: 44,149,944 (GRCm39) probably null Het
Gm4884 C A 7: 40,690,233 (GRCm39) P43Q probably damaging Het
Grm8 A G 6: 27,363,779 (GRCm39) W579R probably damaging Het
Hsdl2 AG AGCAGCAGCCACAGCTGCCG 4: 59,610,657 (GRCm39) probably benign Het
Ivl CTGCTGCTGCTGCTGT C 3: 92,479,650 (GRCm39) probably benign Het
Kif18b T C 11: 102,803,192 (GRCm39) D506G probably benign Het
Krtap28-10 AGCCAC AGCCACGGCCAC 1: 83,019,856 (GRCm39) probably benign Het
Krtap28-10 GCCACAGCCACCACA GCCACAGCCACCACATCCACAGCCACCACA 1: 83,019,995 (GRCm39) probably benign Het
Lama1 C A 17: 68,088,057 (GRCm39) S1558R Het
Lcmt1 C CCGCGGGGCTT 7: 122,969,059 (GRCm39) probably null Het
Lmna A G 3: 88,391,361 (GRCm39) V494A probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,295,542 (GRCm39) probably null Het
Mboat7 T A 7: 3,694,856 (GRCm39) H52L probably damaging Het
Morc2a T A 11: 3,626,191 (GRCm39) M225K probably benign Het
Mpdz G A 4: 81,211,829 (GRCm39) A1566V possibly damaging Het
Mpi T C 9: 57,455,924 (GRCm39) D186G probably benign Het
Mtmr12 C A 15: 12,261,984 (GRCm39) N386K probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 66,977,182 (GRCm39) probably null Het
Myo10 T A 15: 25,799,565 (GRCm39) M1376K probably damaging Het
Nbas C T 12: 13,329,409 (GRCm39) T118I possibly damaging Het
Nedd4l C T 18: 65,342,751 (GRCm39) R755C probably damaging Het
Nefh GACTTGGCCTCACCTGGG GACTTGGCCTCACCTGGGTACTTGGCCTCACCTGGG 11: 4,891,032 (GRCm39) probably benign Het
Numa1 T C 7: 101,648,987 (GRCm39) L906P probably damaging Het
Or6s1 G A 14: 51,308,469 (GRCm39) A127V probably damaging Het
Or7h8 T C 9: 20,124,190 (GRCm39) S182P probably benign Het
Otop2 G T 11: 115,214,492 (GRCm39) R83L probably benign Het
Pmm1 T A 15: 81,842,014 (GRCm39) Q62L probably damaging Het
Pramel16 C G 4: 143,675,478 (GRCm39) Q449H probably damaging Het
Ptprj A T 2: 90,301,514 (GRCm39) L206* probably null Het
Rassf6 TC TCTGCCTCACTCATGGTCCTGTAGAGCATTGGGGATCC 5: 90,756,800 (GRCm39) probably benign Het
Rps19 A AGAAAAT 7: 24,588,605 (GRCm39) probably benign Het
Rsrp1 T A 4: 134,651,266 (GRCm39) V10E unknown Het
Sh2d6 C T 6: 72,493,371 (GRCm39) probably null Het
Six4 TG T 12: 73,150,356 (GRCm39) probably null Het
Slc6a15 T A 10: 103,236,077 (GRCm39) V264D probably damaging Het
Snapc5 ATGGAAGAAGAGG A 9: 64,089,493 (GRCm39) probably benign Het
Sost A T 11: 101,854,958 (GRCm39) I117N probably damaging Het
Spmip5 A G 19: 58,777,726 (GRCm39) F28S probably damaging Het
Tbc1d22a AGGTGTGTG A 15: 86,183,975 (GRCm39) probably null Het
Tcaf1 C T 6: 42,656,107 (GRCm39) V290I probably benign Het
Tcof1 GCA GCACCA 18: 60,968,815 (GRCm39) probably benign Het
Tex55 T C 16: 38,648,363 (GRCm39) T249A probably benign Het
Tgfbr1 A G 4: 47,353,354 (GRCm39) I15V unknown Het
Tmem241 A T 18: 12,116,618 (GRCm39) L288Q probably damaging Het
Tnfrsf13b T G 11: 61,032,270 (GRCm39) V100G probably benign Het
Trim66 A G 7: 109,059,960 (GRCm39) S809P probably damaging Het
Tubb4a C G 17: 57,394,464 (GRCm39) G17A possibly damaging Het
Txndc16 A G 14: 45,406,795 (GRCm39) V220A probably benign Het
Zan T A 5: 137,389,982 (GRCm39) Q4830L unknown Het
Other mutations in Med12l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Med12l APN 3 58,949,757 (GRCm39) missense probably damaging 0.98
IGL00561:Med12l APN 3 59,135,245 (GRCm39) missense probably benign
IGL00974:Med12l APN 3 58,990,435 (GRCm39) missense probably damaging 1.00
IGL01024:Med12l APN 3 58,980,762 (GRCm39) missense probably damaging 1.00
IGL01094:Med12l APN 3 59,001,076 (GRCm39) missense probably damaging 0.99
IGL01134:Med12l APN 3 58,949,696 (GRCm39) missense possibly damaging 0.91
IGL01535:Med12l APN 3 59,169,680 (GRCm39) missense probably damaging 1.00
IGL01653:Med12l APN 3 59,169,314 (GRCm39) missense probably damaging 1.00
IGL01735:Med12l APN 3 59,170,675 (GRCm39) missense probably damaging 1.00
IGL01972:Med12l APN 3 59,169,314 (GRCm39) missense probably damaging 1.00
IGL02005:Med12l APN 3 59,152,368 (GRCm39) missense probably damaging 1.00
IGL02098:Med12l APN 3 59,183,276 (GRCm39) missense possibly damaging 0.92
IGL02115:Med12l APN 3 58,975,740 (GRCm39) missense probably benign 0.00
IGL02231:Med12l APN 3 59,153,303 (GRCm39) missense probably damaging 1.00
IGL02259:Med12l APN 3 59,153,264 (GRCm39) missense probably damaging 1.00
IGL02369:Med12l APN 3 59,164,794 (GRCm39) missense probably benign 0.00
IGL02424:Med12l APN 3 59,000,143 (GRCm39) missense probably benign 0.21
IGL02501:Med12l APN 3 59,169,397 (GRCm39) missense possibly damaging 0.71
IGL02525:Med12l APN 3 58,975,789 (GRCm39) missense probably benign 0.01
IGL02530:Med12l APN 3 58,984,510 (GRCm39) missense probably damaging 1.00
IGL02735:Med12l APN 3 59,001,067 (GRCm39) missense probably damaging 1.00
IGL02865:Med12l APN 3 59,201,713 (GRCm39) missense probably damaging 1.00
IGL03183:Med12l APN 3 58,944,976 (GRCm39) splice site probably null
IGL03264:Med12l APN 3 59,208,788 (GRCm39) nonsense probably null
FR4304:Med12l UTSW 3 59,183,403 (GRCm39) small insertion probably benign
FR4340:Med12l UTSW 3 59,183,406 (GRCm39) small insertion probably benign
FR4342:Med12l UTSW 3 59,183,415 (GRCm39) small insertion probably benign
FR4342:Med12l UTSW 3 59,183,409 (GRCm39) small insertion probably benign
FR4449:Med12l UTSW 3 59,183,384 (GRCm39) nonsense probably null
FR4548:Med12l UTSW 3 59,183,403 (GRCm39) small insertion probably benign
FR4589:Med12l UTSW 3 59,183,377 (GRCm39) small insertion probably benign
FR4976:Med12l UTSW 3 59,183,398 (GRCm39) small insertion probably benign
P0007:Med12l UTSW 3 58,998,816 (GRCm39) splice site probably benign
P0045:Med12l UTSW 3 58,998,956 (GRCm39) missense probably damaging 0.99
R0030:Med12l UTSW 3 59,156,076 (GRCm39) missense probably damaging 1.00
R0030:Med12l UTSW 3 59,156,076 (GRCm39) missense probably damaging 1.00
R0148:Med12l UTSW 3 58,945,075 (GRCm39) missense probably damaging 1.00
R0325:Med12l UTSW 3 58,984,480 (GRCm39) missense possibly damaging 0.88
R0330:Med12l UTSW 3 59,135,123 (GRCm39) missense probably damaging 1.00
R0388:Med12l UTSW 3 59,000,925 (GRCm39) splice site probably benign
R0542:Med12l UTSW 3 58,949,822 (GRCm39) missense probably damaging 1.00
R0624:Med12l UTSW 3 58,945,123 (GRCm39) nonsense probably null
R0625:Med12l UTSW 3 59,154,858 (GRCm39) missense probably damaging 1.00
R0671:Med12l UTSW 3 59,172,350 (GRCm39) missense probably damaging 1.00
R0706:Med12l UTSW 3 59,169,401 (GRCm39) missense probably damaging 1.00
R0785:Med12l UTSW 3 59,168,253 (GRCm39) missense probably damaging 1.00
R1054:Med12l UTSW 3 59,156,072 (GRCm39) missense probably damaging 0.99
R1102:Med12l UTSW 3 59,152,257 (GRCm39) missense probably damaging 0.99
R1391:Med12l UTSW 3 58,945,159 (GRCm39) missense probably benign 0.00
R1501:Med12l UTSW 3 59,168,256 (GRCm39) critical splice donor site probably null
R1544:Med12l UTSW 3 59,172,661 (GRCm39) missense possibly damaging 0.71
R1662:Med12l UTSW 3 59,001,038 (GRCm39) missense probably damaging 1.00
R1670:Med12l UTSW 3 59,183,379 (GRCm39) small insertion probably benign
R1839:Med12l UTSW 3 58,975,740 (GRCm39) missense probably benign
R1854:Med12l UTSW 3 59,168,193 (GRCm39) missense probably damaging 1.00
R2045:Med12l UTSW 3 59,169,731 (GRCm39) nonsense probably null
R2070:Med12l UTSW 3 59,152,326 (GRCm39) missense probably damaging 1.00
R2132:Med12l UTSW 3 59,172,703 (GRCm39) splice site probably null
R2290:Med12l UTSW 3 59,152,359 (GRCm39) missense probably damaging 1.00
R2325:Med12l UTSW 3 59,139,875 (GRCm39) missense probably damaging 0.99
R2352:Med12l UTSW 3 59,148,113 (GRCm39) missense probably damaging 1.00
R2484:Med12l UTSW 3 59,205,259 (GRCm39) missense probably benign 0.18
R2906:Med12l UTSW 3 59,164,503 (GRCm39) missense probably damaging 1.00
R3735:Med12l UTSW 3 58,998,916 (GRCm39) missense probably damaging 1.00
R3736:Med12l UTSW 3 58,998,916 (GRCm39) missense probably damaging 1.00
R3774:Med12l UTSW 3 59,155,363 (GRCm39) missense probably damaging 0.97
R3957:Med12l UTSW 3 58,980,589 (GRCm39) missense probably damaging 0.99
R4020:Med12l UTSW 3 59,155,363 (GRCm39) missense probably damaging 0.97
R4087:Med12l UTSW 3 59,205,342 (GRCm39) missense probably benign 0.00
R4231:Med12l UTSW 3 59,164,644 (GRCm39) splice site probably null
R4233:Med12l UTSW 3 59,164,644 (GRCm39) splice site probably null
R4235:Med12l UTSW 3 59,164,644 (GRCm39) splice site probably null
R4236:Med12l UTSW 3 59,164,644 (GRCm39) splice site probably null
R4327:Med12l UTSW 3 59,172,688 (GRCm39) missense probably benign 0.01
R4328:Med12l UTSW 3 59,172,688 (GRCm39) missense probably benign 0.01
R4346:Med12l UTSW 3 58,938,976 (GRCm39) missense probably damaging 1.00
R4543:Med12l UTSW 3 58,998,929 (GRCm39) missense probably damaging 1.00
R4559:Med12l UTSW 3 58,914,523 (GRCm39) critical splice donor site probably null
R4776:Med12l UTSW 3 59,140,633 (GRCm39) missense probably damaging 1.00
R4877:Med12l UTSW 3 59,152,214 (GRCm39) missense probably damaging 1.00
R4983:Med12l UTSW 3 59,169,350 (GRCm39) missense probably damaging 1.00
R5114:Med12l UTSW 3 59,167,109 (GRCm39) missense possibly damaging 0.85
R5125:Med12l UTSW 3 59,174,635 (GRCm39) missense possibly damaging 0.83
R5230:Med12l UTSW 3 59,153,209 (GRCm39) missense probably damaging 1.00
R5407:Med12l UTSW 3 59,165,622 (GRCm39) missense probably damaging 1.00
R5426:Med12l UTSW 3 59,156,143 (GRCm39) missense probably damaging 0.98
R5439:Med12l UTSW 3 59,170,634 (GRCm39) missense probably null 1.00
R5449:Med12l UTSW 3 59,167,127 (GRCm39) missense probably damaging 1.00
R5596:Med12l UTSW 3 59,159,771 (GRCm39) missense probably benign 0.45
R5716:Med12l UTSW 3 59,208,798 (GRCm39) critical splice donor site probably null
R5833:Med12l UTSW 3 59,172,647 (GRCm39) missense possibly damaging 0.95
R5883:Med12l UTSW 3 58,998,889 (GRCm39) missense probably damaging 1.00
R6264:Med12l UTSW 3 59,163,423 (GRCm39) missense probably damaging 1.00
R6269:Med12l UTSW 3 59,135,243 (GRCm39) missense probably damaging 1.00
R6394:Med12l UTSW 3 59,142,508 (GRCm39) missense probably damaging 1.00
R6400:Med12l UTSW 3 59,155,332 (GRCm39) missense probably damaging 1.00
R6475:Med12l UTSW 3 59,164,500 (GRCm39) missense probably damaging 1.00
R6489:Med12l UTSW 3 59,164,828 (GRCm39) missense probably damaging 0.99
R6654:Med12l UTSW 3 59,169,713 (GRCm39) missense probably damaging 1.00
R6881:Med12l UTSW 3 59,174,586 (GRCm39) missense probably benign 0.00
R7110:Med12l UTSW 3 59,169,645 (GRCm39) missense possibly damaging 0.92
R7134:Med12l UTSW 3 59,001,180 (GRCm39) nonsense probably null
R7137:Med12l UTSW 3 59,165,675 (GRCm39) missense probably damaging 1.00
R7159:Med12l UTSW 3 59,183,438 (GRCm39) missense probably benign
R7341:Med12l UTSW 3 58,949,824 (GRCm39) missense possibly damaging 0.53
R7349:Med12l UTSW 3 59,165,746 (GRCm39) missense probably damaging 1.00
R7413:Med12l UTSW 3 58,998,971 (GRCm39) missense probably benign 0.00
R7495:Med12l UTSW 3 59,152,194 (GRCm39) missense probably damaging 1.00
R7678:Med12l UTSW 3 58,984,141 (GRCm39) missense probably damaging 1.00
R7697:Med12l UTSW 3 59,148,078 (GRCm39) missense probably damaging 1.00
R7714:Med12l UTSW 3 59,001,007 (GRCm39) missense probably benign 0.17
R7725:Med12l UTSW 3 59,163,413 (GRCm39) missense probably damaging 1.00
R7846:Med12l UTSW 3 59,172,355 (GRCm39) missense probably damaging 1.00
R7852:Med12l UTSW 3 59,155,332 (GRCm39) missense probably damaging 1.00
R8080:Med12l UTSW 3 59,172,607 (GRCm39) missense probably damaging 1.00
R8181:Med12l UTSW 3 59,169,389 (GRCm39) missense probably damaging 1.00
R8223:Med12l UTSW 3 58,993,784 (GRCm39) missense possibly damaging 0.79
R8560:Med12l UTSW 3 58,945,026 (GRCm39) missense probably damaging 1.00
R8708:Med12l UTSW 3 59,159,751 (GRCm39) missense probably benign 0.00
R8865:Med12l UTSW 3 58,979,303 (GRCm39) missense probably benign
R8947:Med12l UTSW 3 58,984,443 (GRCm39) splice site probably benign
R8976:Med12l UTSW 3 59,183,329 (GRCm39) missense probably damaging 0.99
R9016:Med12l UTSW 3 59,163,294 (GRCm39) missense probably damaging 0.96
R9183:Med12l UTSW 3 58,984,498 (GRCm39) missense probably damaging 1.00
R9487:Med12l UTSW 3 59,155,353 (GRCm39) missense probably benign
R9526:Med12l UTSW 3 58,984,207 (GRCm39) missense probably damaging 0.96
R9802:Med12l UTSW 3 59,169,346 (GRCm39) missense probably damaging 1.00
RF004:Med12l UTSW 3 59,183,390 (GRCm39) small insertion probably benign
RF011:Med12l UTSW 3 59,183,401 (GRCm39) small insertion probably benign
RF020:Med12l UTSW 3 59,183,379 (GRCm39) small insertion probably benign
RF021:Med12l UTSW 3 58,980,711 (GRCm39) missense probably benign 0.19
RF027:Med12l UTSW 3 59,183,402 (GRCm39) small insertion probably benign
RF027:Med12l UTSW 3 59,183,388 (GRCm39) small insertion probably benign
RF030:Med12l UTSW 3 59,183,410 (GRCm39) small insertion probably benign
RF032:Med12l UTSW 3 59,183,410 (GRCm39) small insertion probably benign
RF032:Med12l UTSW 3 59,183,406 (GRCm39) small insertion probably benign
RF032:Med12l UTSW 3 59,183,402 (GRCm39) small insertion probably benign
RF033:Med12l UTSW 3 59,183,416 (GRCm39) small insertion probably benign
RF033:Med12l UTSW 3 59,183,408 (GRCm39) small insertion probably benign
RF033:Med12l UTSW 3 59,183,402 (GRCm39) small insertion probably benign
RF037:Med12l UTSW 3 59,183,377 (GRCm39) small insertion probably benign
RF040:Med12l UTSW 3 59,183,410 (GRCm39) small insertion probably benign
RF040:Med12l UTSW 3 59,183,388 (GRCm39) small insertion probably benign
RF041:Med12l UTSW 3 59,183,416 (GRCm39) small insertion probably benign
RF041:Med12l UTSW 3 59,183,406 (GRCm39) small insertion probably benign
RF042:Med12l UTSW 3 59,183,402 (GRCm39) small insertion probably benign
RF042:Med12l UTSW 3 59,183,388 (GRCm39) small insertion probably benign
RF042:Med12l UTSW 3 59,183,377 (GRCm39) small insertion probably benign
RF042:Med12l UTSW 3 59,183,416 (GRCm39) small insertion probably benign
RF049:Med12l UTSW 3 59,183,390 (GRCm39) small insertion probably benign
RF050:Med12l UTSW 3 59,183,394 (GRCm39) small insertion probably benign
RF053:Med12l UTSW 3 59,183,414 (GRCm39) small insertion probably benign
RF055:Med12l UTSW 3 59,183,404 (GRCm39) small insertion probably benign
RF056:Med12l UTSW 3 59,183,414 (GRCm39) small insertion probably benign
RF057:Med12l UTSW 3 59,183,401 (GRCm39) small insertion probably benign
RF063:Med12l UTSW 3 59,183,394 (GRCm39) small insertion probably benign
RF063:Med12l UTSW 3 59,183,379 (GRCm39) small insertion probably benign
X0062:Med12l UTSW 3 59,140,600 (GRCm39) missense probably damaging 1.00
Z1176:Med12l UTSW 3 59,203,538 (GRCm39) missense probably benign 0.00
Z1176:Med12l UTSW 3 59,152,364 (GRCm39) missense probably damaging 1.00
Z1176:Med12l UTSW 3 58,998,838 (GRCm39) missense probably damaging 0.98
Z1177:Med12l UTSW 3 59,155,296 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTAGGTGGCTCCCGATTG -3'
(R):5'- AGTCCTTAGCACTTTGGGCTTC -3'

Sequencing Primer
(F):5'- TCCCGATTGGACCCTGC -3'
(R):5'- GGGCTTCTTCCCAAGATCAATAATG -3'
Posted On 2019-12-04