Incidental Mutation 'RF013:Tgfbr1'
ID 603318
Institutional Source Beutler Lab
Gene Symbol Tgfbr1
Ensembl Gene ENSMUSG00000007613
Gene Name transforming growth factor, beta receptor I
Synonyms TbetaRI, ALK5, TbetaR-I, Alk-5
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # RF013 (G1)
Quality Score 98.0078
Status Not validated
Chromosome 4
Chromosomal Location 47353222-47414931 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 47353354 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 15 (I15V)
Ref Sequence ENSEMBL: ENSMUSP00000007757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007757] [ENSMUST00000044234] [ENSMUST00000126171]
AlphaFold Q64729
Predicted Effect unknown
Transcript: ENSMUST00000007757
AA Change: I15V
SMART Domains Protein: ENSMUSP00000007757
Gene: ENSMUSG00000007613
AA Change: I15V

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 13 24 N/A INTRINSIC
Pfam:Activin_recp 30 110 2.7e-16 PFAM
transmembrane domain 126 148 N/A INTRINSIC
GS 175 205 1.01e-14 SMART
Blast:STYKc 207 492 7e-31 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000044234
AA Change: I15V
SMART Domains Protein: ENSMUSP00000048501
Gene: ENSMUSG00000007613
AA Change: I15V

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 13 24 N/A INTRINSIC
Pfam:Activin_recp 30 110 1.6e-14 PFAM
transmembrane domain 122 144 N/A INTRINSIC
GS 171 201 1.01e-14 SMART
Blast:STYKc 203 488 8e-31 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000126171
SMART Domains Protein: ENSMUSP00000123761
Gene: ENSMUSG00000007613

DomainStartEndE-ValueType
PDB:3KFD|L 1 45 3e-26 PDB
transmembrane domain 57 79 N/A INTRINSIC
GS 106 136 1.01e-14 SMART
Blast:STYKc 138 423 3e-31 BLAST
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the transforming growth factor beta (TGF-beta) receptor family of proteins. These proteins comprise one component of the TGF-beta signaling pathway, which transduces extracellular signals into gene expression changes to regulate a wide range of cellular responses, including proliferation, migration, differentiation and apoptosis. Homozygous knockout mice for this gene exhibit impaired angiogenesis and embryonic lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for some targeted null mutations exhibit defects of the yolk sac and placenta, lack circulating erythrocytes, and die at midgestation. Mutant endothelial cells show enhanced proliferation, improper migration, and reduced fibronectin production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A G 19: 58,789,294 F28S probably damaging Het
4930435E12Rik T C 16: 38,828,001 T249A probably benign Het
4932438A13Rik TTAT TTATTATTATTATTAGTAT 3: 37,050,757 probably benign Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,905,096 probably benign Het
Adamts9 A G 6: 92,943,145 V4A possibly damaging Het
AI837181 GGC GGCTGC 19: 5,425,232 probably benign Het
Alk A G 17: 71,895,936 Y1135H probably damaging Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,560,926 probably benign Het
Ano3 A C 2: 110,697,036 L609R probably benign Het
Bicc1 A G 10: 70,935,830 probably null Het
Card6 T C 15: 5,100,142 I591V probably benign Het
Ccdc18 A G 5: 108,220,716 N1235D probably benign Het
Cd109 TTAT TTATTTATTTATCTAT 9: 78,712,531 probably benign Het
Cnpy3 CCT CCTGCT 17: 46,736,744 probably benign Het
Col6a5 GCAGTC GCAGTCTCCAGTC 9: 105,878,597 probably null Het
Cyb5r4 GACACACTGCCCAGGGA GACACACTGCCCAGGGATGTGACACACACACTGCCCAGGGA 9: 87,040,432 probably benign Het
Cyp8b1 A T 9: 121,915,495 M257K possibly damaging Het
Dbf4 A T 5: 8,397,985 H408Q possibly damaging Het
Defb22 TTGCGGCA TTGCGGCAGAGCTGGCCTGTGCGGCA 2: 152,485,831 probably benign Het
Ercc6l2 A T 13: 63,853,017 T417S probably benign Het
Exd2 AGCCACAG A 12: 80,475,932 probably null Het
Fam171b GC GCAGCATC 2: 83,812,895 probably benign Het
Fam71e1 CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGACGGCTGGATCCTGGATCACTGGGTCTGAGGGAGGA 7: 44,500,520 probably null Het
Flvcr2 T A 12: 85,747,186 L112Q probably damaging Het
Flywch1 GTG GTGGGGGGAGGCTACGTACTCACCCACTCCTTTTG 17: 23,762,175 probably null Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 72,270,416 probably benign Het
Gm4884 C A 7: 41,040,809 P43Q probably damaging Het
Gm6588 T A 5: 112,450,071 N161K probably benign Het
Grm8 A G 6: 27,363,780 W579R probably damaging Het
Hsdl2 AG AGCAGCAGCCACAGCTGCCG 4: 59,610,657 probably benign Het
Ivl CTGCTGCTGCTGCTGT C 3: 92,572,343 probably benign Het
Kif18b T C 11: 102,912,366 D506G probably benign Het
Krtap28-10 AGCCAC AGCCACGGCCAC 1: 83,042,135 probably benign Het
Krtap28-10 GCCACAGCCACCACA GCCACAGCCACCACATCCACAGCCACCACA 1: 83,042,274 probably benign Het
Lama1 C A 17: 67,781,062 S1558R Het
Lcmt1 C CCGCGGGGCTT 7: 123,369,836 probably null Het
Lmna A G 3: 88,484,054 V494A probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,388,260 probably null Het
Mboat7 T A 7: 3,691,857 H52L probably damaging Het
Med12l CAG CAGAAG 3: 59,275,966 probably benign Het
Morc2a T A 11: 3,676,191 M225K probably benign Het
Mpdz G A 4: 81,293,592 A1566V possibly damaging Het
Mpi T C 9: 57,548,641 D186G probably benign Het
Mtmr12 C A 15: 12,261,898 N386K probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myo10 T A 15: 25,799,479 M1376K probably damaging Het
Nbas C T 12: 13,279,408 T118I possibly damaging Het
Nedd4l C T 18: 65,209,680 R755C probably damaging Het
Nefh GACTTGGCCTCACCTGGG GACTTGGCCTCACCTGGGTACTTGGCCTCACCTGGG 11: 4,941,032 probably benign Het
Numa1 T C 7: 101,999,780 L906P probably damaging Het
Olfr750 G A 14: 51,071,012 A127V probably damaging Het
Olfr871 T C 9: 20,212,894 S182P probably benign Het
Otop2 G T 11: 115,323,666 R83L probably benign Het
Pmm1 T A 15: 81,957,813 Q62L probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Ptprj A T 2: 90,471,170 L206* probably null Het
Rassf6 TC TCTGCCTCACTCATGGTCCTGTAGAGCATTGGGGATCC 5: 90,608,941 probably benign Het
Rps19 A AGAAAAT 7: 24,889,180 probably benign Het
Rsrp1 T A 4: 134,923,955 V10E unknown Het
Sh2d6 C T 6: 72,516,388 probably null Het
Six4 TG T 12: 73,103,582 probably null Het
Slc6a15 T A 10: 103,400,216 V264D probably damaging Het
Snapc5 ATGGAAGAAGAGG A 9: 64,182,211 probably benign Het
Sost A T 11: 101,964,132 I117N probably damaging Het
Tbc1d22a AGGTGTGTG A 15: 86,299,774 probably null Het
Tcaf1 C T 6: 42,679,173 V290I probably benign Het
Tcof1 GCA GCACCA 18: 60,835,743 probably benign Het
Tmem241 A T 18: 11,983,561 L288Q probably damaging Het
Tnfrsf13b T G 11: 61,141,444 V100G probably benign Het
Trim66 A G 7: 109,460,753 S809P probably damaging Het
Tubb4a C G 17: 57,087,464 G17A possibly damaging Het
Txndc16 A G 14: 45,169,338 V220A probably benign Het
Zan T A 5: 137,391,720 Q4830L unknown Het
Other mutations in Tgfbr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Tgfbr1 APN 4 47383992 missense probably benign 0.00
IGL00757:Tgfbr1 APN 4 47405581 missense probably damaging 1.00
IGL02001:Tgfbr1 APN 4 47403388 missense probably damaging 1.00
IGL02207:Tgfbr1 APN 4 47410785 utr 3 prime probably benign
IGL02338:Tgfbr1 APN 4 47393490 critical splice donor site probably null
PIT4480001:Tgfbr1 UTSW 4 47402955 missense probably benign 0.44
R0097:Tgfbr1 UTSW 4 47403451 nonsense probably null
R0097:Tgfbr1 UTSW 4 47403451 nonsense probably null
R1299:Tgfbr1 UTSW 4 47396587 critical splice donor site probably null
R1444:Tgfbr1 UTSW 4 47393259 missense probably benign
R1530:Tgfbr1 UTSW 4 47410688 missense probably damaging 1.00
R1591:Tgfbr1 UTSW 4 47403471 missense probably damaging 1.00
R1611:Tgfbr1 UTSW 4 47396526 missense probably damaging 1.00
R2327:Tgfbr1 UTSW 4 47402833 missense probably damaging 1.00
R4352:Tgfbr1 UTSW 4 47402863 missense probably damaging 1.00
R4736:Tgfbr1 UTSW 4 47383835 missense probably benign
R5180:Tgfbr1 UTSW 4 47383948 nonsense probably null
R5907:Tgfbr1 UTSW 4 47396555 missense probably damaging 1.00
R6462:Tgfbr1 UTSW 4 47402846 missense probably damaging 1.00
R6842:Tgfbr1 UTSW 4 47383757 missense probably damaging 1.00
R7017:Tgfbr1 UTSW 4 47410728 missense probably damaging 0.99
R7206:Tgfbr1 UTSW 4 47402941 missense probably damaging 1.00
R7402:Tgfbr1 UTSW 4 47405623 missense probably damaging 1.00
R7862:Tgfbr1 UTSW 4 47403489 missense probably damaging 0.99
R8210:Tgfbr1 UTSW 4 47406924 missense probably benign 0.01
R8787:Tgfbr1 UTSW 4 47405555 missense possibly damaging 0.94
Z1176:Tgfbr1 UTSW 4 47353790 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CTCGAGCAGTTACAAAGGGC -3'
(R):5'- CATTTAGGCAGTGGAATCAGGG -3'

Sequencing Primer
(F):5'- CAGTTACAAAGGGCCGGAGC -3'
(R):5'- TGGAATCAGGGGGCCAC -3'
Posted On 2019-12-04