Incidental Mutation 'RF013:Acap3'
ID603323
Institutional Source Beutler Lab
Gene Symbol Acap3
Ensembl Gene ENSMUSG00000029033
Gene NameArfGAP with coiled-coil, ankyrin repeat and PH domains 3
SynonymsCentb5, Kiaa1716-hp
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #RF013 (G1)
Quality Score215.916
Status Not validated
Chromosome4
Chromosomal Location155891822-155907251 bp(+) (GRCm38)
Type of Mutationsmall insertion (5 aa in frame mutation)
DNA Base Change (assembly) CCTGGGCTGCTG to CCTGGGCTGCTGCATACTGGGCTGCTG at 155905096 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079031] [ENSMUST00000105584]
Predicted Effect probably benign
Transcript: ENSMUST00000079031
SMART Domains Protein: ENSMUSP00000078040
Gene: ENSMUSG00000029033

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
PH 265 361 6.35e-16 SMART
low complexity region 377 391 N/A INTRINSIC
ArfGap 399 521 4.62e-56 SMART
low complexity region 554 566 N/A INTRINSIC
low complexity region 601 617 N/A INTRINSIC
low complexity region 628 650 N/A INTRINSIC
low complexity region 669 686 N/A INTRINSIC
ANK 696 725 3.91e-3 SMART
ANK 729 758 2.43e1 SMART
low complexity region 781 796 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105584
SMART Domains Protein: ENSMUSP00000101209
Gene: ENSMUSG00000029033

DomainStartEndE-ValueType
Pfam:BAR_3 3 236 4.1e-95 PFAM
PH 269 365 6.35e-16 SMART
low complexity region 381 395 N/A INTRINSIC
ArfGap 403 525 4.62e-56 SMART
low complexity region 558 570 N/A INTRINSIC
low complexity region 605 621 N/A INTRINSIC
low complexity region 632 654 N/A INTRINSIC
low complexity region 673 690 N/A INTRINSIC
ANK 700 729 3.91e-3 SMART
ANK 733 762 2.43e1 SMART
low complexity region 785 800 N/A INTRINSIC
low complexity region 801 813 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A G 19: 58,789,294 F28S probably damaging Het
4930435E12Rik T C 16: 38,828,001 T249A probably benign Het
4932438A13Rik TTAT TTATTATTATTATTAGTAT 3: 37,050,757 probably benign Het
Adamts9 A G 6: 92,943,145 V4A possibly damaging Het
AI837181 GGC GGCTGC 19: 5,425,232 probably benign Het
Alk A G 17: 71,895,936 Y1135H probably damaging Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,560,926 probably benign Het
Ano3 A C 2: 110,697,036 L609R probably benign Het
Bicc1 A G 10: 70,935,830 probably null Het
Card6 T C 15: 5,100,142 I591V probably benign Het
Ccdc18 A G 5: 108,220,716 N1235D probably benign Het
Cd109 TTAT TTATTTATTTATCTAT 9: 78,712,531 probably benign Het
Cnpy3 CCT CCTGCT 17: 46,736,744 probably benign Het
Col6a5 GCAGTC GCAGTCTCCAGTC 9: 105,878,597 probably null Het
Cyb5r4 GACACACTGCCCAGGGA GACACACTGCCCAGGGATGTGACACACACACTGCCCAGGGA 9: 87,040,432 probably benign Het
Cyp8b1 A T 9: 121,915,495 M257K possibly damaging Het
Dbf4 A T 5: 8,397,985 H408Q possibly damaging Het
Defb22 TTGCGGCA TTGCGGCAGAGCTGGCCTGTGCGGCA 2: 152,485,831 probably benign Het
Ercc6l2 A T 13: 63,853,017 T417S probably benign Het
Exd2 AGCCACAG A 12: 80,475,932 probably null Het
Fam171b GC GCAGCATC 2: 83,812,895 probably benign Het
Fam71e1 CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGACGGCTGGATCCTGGATCACTGGGTCTGAGGGAGGA 7: 44,500,520 probably null Het
Flvcr2 T A 12: 85,747,186 L112Q probably damaging Het
Flywch1 GTG GTGGGGGGAGGCTACGTACTCACCCACTCCTTTTG 17: 23,762,175 probably null Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 72,270,416 probably benign Het
Gm4884 C A 7: 41,040,809 P43Q probably damaging Het
Gm6588 T A 5: 112,450,071 N161K probably benign Het
Grm8 A G 6: 27,363,780 W579R probably damaging Het
Hsdl2 AG AGCAGCAGCCACAGCTGCCG 4: 59,610,657 probably benign Het
Ivl CTGCTGCTGCTGCTGT C 3: 92,572,343 probably benign Het
Kif18b T C 11: 102,912,366 D506G probably benign Het
Krtap28-10 AGCCAC AGCCACGGCCAC 1: 83,042,135 probably benign Het
Krtap28-10 GCCACAGCCACCACA GCCACAGCCACCACATCCACAGCCACCACA 1: 83,042,274 probably benign Het
Lama1 C A 17: 67,781,062 S1558R Het
Lcmt1 C CCGCGGGGCTT 7: 123,369,836 probably null Het
Lmna A G 3: 88,484,054 V494A probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,388,260 probably null Het
Mboat7 T A 7: 3,691,857 H52L probably damaging Het
Med12l CAG CAGAAG 3: 59,275,966 probably benign Het
Morc2a T A 11: 3,676,191 M225K probably benign Het
Mpdz G A 4: 81,293,592 A1566V possibly damaging Het
Mpi T C 9: 57,548,641 D186G probably benign Het
Mtmr12 C A 15: 12,261,898 N386K probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myo10 T A 15: 25,799,479 M1376K probably damaging Het
Nbas C T 12: 13,279,408 T118I possibly damaging Het
Nedd4l C T 18: 65,209,680 R755C probably damaging Het
Nefh GACTTGGCCTCACCTGGG GACTTGGCCTCACCTGGGTACTTGGCCTCACCTGGG 11: 4,941,032 probably benign Het
Numa1 T C 7: 101,999,780 L906P probably damaging Het
Olfr750 G A 14: 51,071,012 A127V probably damaging Het
Olfr871 T C 9: 20,212,894 S182P probably benign Het
Otop2 G T 11: 115,323,666 R83L probably benign Het
Pmm1 T A 15: 81,957,813 Q62L probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Ptprj A T 2: 90,471,170 L206* probably null Het
Rassf6 TC TCTGCCTCACTCATGGTCCTGTAGAGCATTGGGGATCC 5: 90,608,941 probably benign Het
Rps19 A AGAAAAT 7: 24,889,180 probably benign Het
Rsrp1 T A 4: 134,923,955 V10E unknown Het
Sh2d6 C T 6: 72,516,388 probably null Het
Six4 TG T 12: 73,103,582 probably null Het
Slc6a15 T A 10: 103,400,216 V264D probably damaging Het
Snapc5 ATGGAAGAAGAGG A 9: 64,182,211 probably benign Het
Sost A T 11: 101,964,132 I117N probably damaging Het
Tbc1d22a AGGTGTGTG A 15: 86,299,774 probably null Het
Tcaf1 C T 6: 42,679,173 V290I probably benign Het
Tcof1 GCA GCACCA 18: 60,835,743 probably benign Het
Tgfbr1 A G 4: 47,353,354 I15V unknown Het
Tmem241 A T 18: 11,983,561 L288Q probably damaging Het
Tnfrsf13b T G 11: 61,141,444 V100G probably benign Het
Trim66 A G 7: 109,460,753 S809P probably damaging Het
Tubb4a C G 17: 57,087,464 G17A possibly damaging Het
Txndc16 A G 14: 45,169,338 V220A probably benign Het
Zan T A 5: 137,391,720 Q4830L unknown Het
Other mutations in Acap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Acap3 APN 4 155902219 missense probably damaging 0.99
IGL01815:Acap3 APN 4 155902187 missense probably damaging 1.00
IGL02104:Acap3 APN 4 155905085 missense probably damaging 1.00
IGL02387:Acap3 APN 4 155902160 missense probably damaging 1.00
IGL02544:Acap3 APN 4 155892410 missense possibly damaging 0.93
IGL03124:Acap3 APN 4 155905033 missense probably benign 0.00
IGL03052:Acap3 UTSW 4 155903358 missense probably damaging 1.00
PIT4514001:Acap3 UTSW 4 155903378 missense probably benign 0.00
R0207:Acap3 UTSW 4 155899424 missense probably damaging 1.00
R0452:Acap3 UTSW 4 155902328 nonsense probably null
R1110:Acap3 UTSW 4 155905399 splice site probably null
R1387:Acap3 UTSW 4 155899480 missense probably benign 0.06
R1475:Acap3 UTSW 4 155902821 missense probably damaging 1.00
R1535:Acap3 UTSW 4 155896174 splice site probably benign
R2136:Acap3 UTSW 4 155896912 missense probably damaging 1.00
R2149:Acap3 UTSW 4 155905625 missense probably damaging 1.00
R2218:Acap3 UTSW 4 155903862 splice site probably null
R2897:Acap3 UTSW 4 155904931 splice site probably null
R2898:Acap3 UTSW 4 155903459 missense possibly damaging 0.88
R2898:Acap3 UTSW 4 155904931 splice site probably null
R3008:Acap3 UTSW 4 155905682 missense probably benign 0.37
R4170:Acap3 UTSW 4 155900001 missense possibly damaging 0.85
R4193:Acap3 UTSW 4 155901777 missense probably benign 0.07
R4822:Acap3 UTSW 4 155902451 intron probably benign
R4882:Acap3 UTSW 4 155905655 missense probably damaging 0.99
R5482:Acap3 UTSW 4 155900156 missense probably benign 0.00
R5655:Acap3 UTSW 4 155896619 missense probably benign 0.22
R5769:Acap3 UTSW 4 155902400 missense probably damaging 0.99
R5943:Acap3 UTSW 4 155899422 missense possibly damaging 0.78
R6236:Acap3 UTSW 4 155905207 missense possibly damaging 0.91
R6259:Acap3 UTSW 4 155896118 missense possibly damaging 0.91
R6790:Acap3 UTSW 4 155902991 missense probably damaging 1.00
R7000:Acap3 UTSW 4 155903849 missense possibly damaging 0.79
R7352:Acap3 UTSW 4 155905711 missense possibly damaging 0.56
R7442:Acap3 UTSW 4 155905621 missense probably damaging 0.98
RF008:Acap3 UTSW 4 155905098 small insertion probably benign
RF010:Acap3 UTSW 4 155905096 small insertion probably benign
RF022:Acap3 UTSW 4 155905096 small insertion probably benign
RF025:Acap3 UTSW 4 155905102 small insertion probably benign
RF028:Acap3 UTSW 4 155905091 small insertion probably benign
RF032:Acap3 UTSW 4 155905102 small insertion probably benign
RF034:Acap3 UTSW 4 155905092 small insertion probably benign
RF035:Acap3 UTSW 4 155905091 small insertion probably benign
RF036:Acap3 UTSW 4 155905087 small insertion probably benign
RF038:Acap3 UTSW 4 155905092 small insertion probably benign
RF039:Acap3 UTSW 4 155905092 small insertion probably benign
RF041:Acap3 UTSW 4 155905100 small insertion probably benign
RF064:Acap3 UTSW 4 155905100 small insertion probably benign
Z1176:Acap3 UTSW 4 155905179 missense probably damaging 1.00
Z1177:Acap3 UTSW 4 155905518 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTCAGATGTTCTTGCCTTCG -3'
(R):5'- CACACGTAGGTATGCAGTCTTG -3'

Sequencing Primer
(F):5'- AGTGGTGGACAGTGTCACC -3'
(R):5'- GTTTTTCATATAAGCCCTGCCTGTG -3'
Posted On2019-12-04