Incidental Mutation 'RF013:Dbf4'
ID 603324
Institutional Source Beutler Lab
Gene Symbol Dbf4
Ensembl Gene ENSMUSG00000002297
Gene Name DBF4 zinc finger
Synonyms Ask
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # RF013 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 8396973-8422716 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 8397985 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 408 (H408Q)
Ref Sequence ENSEMBL: ENSMUSP00000132906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002368] [ENSMUST00000168500] [ENSMUST00000171808]
AlphaFold Q9QZ41
Predicted Effect possibly damaging
Transcript: ENSMUST00000002368
AA Change: H407Q

PolyPhen 2 Score 0.608 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000002368
Gene: ENSMUSG00000002297
AA Change: H407Q

DomainStartEndE-ValueType
Blast:BRCT 44 181 9e-85 BLAST
low complexity region 182 204 N/A INTRINSIC
ZnF_DBF 287 334 7.09e-28 SMART
low complexity region 643 657 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163141
SMART Domains Protein: ENSMUSP00000129317
Gene: ENSMUSG00000002297

DomainStartEndE-ValueType
ZnF_DBF 19 66 7.09e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168500
SMART Domains Protein: ENSMUSP00000132985
Gene: ENSMUSG00000002297

DomainStartEndE-ValueType
Pfam:BRCT 41 179 2e-7 PFAM
low complexity region 182 204 N/A INTRINSIC
PDB:4F9C|B 210 308 2e-42 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000171808
AA Change: H408Q

PolyPhen 2 Score 0.473 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132906
Gene: ENSMUSG00000002297
AA Change: H408Q

DomainStartEndE-ValueType
Blast:BRCT 44 181 9e-85 BLAST
low complexity region 182 204 N/A INTRINSIC
ZnF_DBF 288 335 7.09e-28 SMART
low complexity region 644 658 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A G 19: 58,789,294 F28S probably damaging Het
4930435E12Rik T C 16: 38,828,001 T249A probably benign Het
4932438A13Rik TTAT TTATTATTATTATTAGTAT 3: 37,050,757 probably benign Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,905,096 probably benign Het
Adamts9 A G 6: 92,943,145 V4A possibly damaging Het
AI837181 GGC GGCTGC 19: 5,425,232 probably benign Het
Alk A G 17: 71,895,936 Y1135H probably damaging Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,560,926 probably benign Het
Ano3 A C 2: 110,697,036 L609R probably benign Het
Bicc1 A G 10: 70,935,830 probably null Het
Card6 T C 15: 5,100,142 I591V probably benign Het
Ccdc18 A G 5: 108,220,716 N1235D probably benign Het
Cd109 TTAT TTATTTATTTATCTAT 9: 78,712,531 probably benign Het
Cnpy3 CCT CCTGCT 17: 46,736,744 probably benign Het
Col6a5 GCAGTC GCAGTCTCCAGTC 9: 105,878,597 probably null Het
Cyb5r4 GACACACTGCCCAGGGA GACACACTGCCCAGGGATGTGACACACACACTGCCCAGGGA 9: 87,040,432 probably benign Het
Cyp8b1 A T 9: 121,915,495 M257K possibly damaging Het
Defb22 TTGCGGCA TTGCGGCAGAGCTGGCCTGTGCGGCA 2: 152,485,831 probably benign Het
Ercc6l2 A T 13: 63,853,017 T417S probably benign Het
Exd2 AGCCACAG A 12: 80,475,932 probably null Het
Fam171b GC GCAGCATC 2: 83,812,895 probably benign Het
Fam71e1 CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGACGGCTGGATCCTGGATCACTGGGTCTGAGGGAGGA 7: 44,500,520 probably null Het
Flvcr2 T A 12: 85,747,186 L112Q probably damaging Het
Flywch1 GTG GTGGGGGGAGGCTACGTACTCACCCACTCCTTTTG 17: 23,762,175 probably null Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 72,270,416 probably benign Het
Gm4884 C A 7: 41,040,809 P43Q probably damaging Het
Gm6588 T A 5: 112,450,071 N161K probably benign Het
Grm8 A G 6: 27,363,780 W579R probably damaging Het
Hsdl2 AG AGCAGCAGCCACAGCTGCCG 4: 59,610,657 probably benign Het
Ivl CTGCTGCTGCTGCTGT C 3: 92,572,343 probably benign Het
Kif18b T C 11: 102,912,366 D506G probably benign Het
Krtap28-10 AGCCAC AGCCACGGCCAC 1: 83,042,135 probably benign Het
Krtap28-10 GCCACAGCCACCACA GCCACAGCCACCACATCCACAGCCACCACA 1: 83,042,274 probably benign Het
Lama1 C A 17: 67,781,062 S1558R Het
Lcmt1 C CCGCGGGGCTT 7: 123,369,836 probably null Het
Lmna A G 3: 88,484,054 V494A probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,388,260 probably null Het
Mboat7 T A 7: 3,691,857 H52L probably damaging Het
Med12l CAG CAGAAG 3: 59,275,966 probably benign Het
Morc2a T A 11: 3,676,191 M225K probably benign Het
Mpdz G A 4: 81,293,592 A1566V possibly damaging Het
Mpi T C 9: 57,548,641 D186G probably benign Het
Mtmr12 C A 15: 12,261,898 N386K probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myo10 T A 15: 25,799,479 M1376K probably damaging Het
Nbas C T 12: 13,279,408 T118I possibly damaging Het
Nedd4l C T 18: 65,209,680 R755C probably damaging Het
Nefh GACTTGGCCTCACCTGGG GACTTGGCCTCACCTGGGTACTTGGCCTCACCTGGG 11: 4,941,032 probably benign Het
Numa1 T C 7: 101,999,780 L906P probably damaging Het
Olfr750 G A 14: 51,071,012 A127V probably damaging Het
Olfr871 T C 9: 20,212,894 S182P probably benign Het
Otop2 G T 11: 115,323,666 R83L probably benign Het
Pmm1 T A 15: 81,957,813 Q62L probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Ptprj A T 2: 90,471,170 L206* probably null Het
Rassf6 TC TCTGCCTCACTCATGGTCCTGTAGAGCATTGGGGATCC 5: 90,608,941 probably benign Het
Rps19 A AGAAAAT 7: 24,889,180 probably benign Het
Rsrp1 T A 4: 134,923,955 V10E unknown Het
Sh2d6 C T 6: 72,516,388 probably null Het
Six4 TG T 12: 73,103,582 probably null Het
Slc6a15 T A 10: 103,400,216 V264D probably damaging Het
Snapc5 ATGGAAGAAGAGG A 9: 64,182,211 probably benign Het
Sost A T 11: 101,964,132 I117N probably damaging Het
Tbc1d22a AGGTGTGTG A 15: 86,299,774 probably null Het
Tcaf1 C T 6: 42,679,173 V290I probably benign Het
Tcof1 GCA GCACCA 18: 60,835,743 probably benign Het
Tgfbr1 A G 4: 47,353,354 I15V unknown Het
Tmem241 A T 18: 11,983,561 L288Q probably damaging Het
Tnfrsf13b T G 11: 61,141,444 V100G probably benign Het
Trim66 A G 7: 109,460,753 S809P probably damaging Het
Tubb4a C G 17: 57,087,464 G17A possibly damaging Het
Txndc16 A G 14: 45,169,338 V220A probably benign Het
Zan T A 5: 137,391,720 Q4830L unknown Het
Other mutations in Dbf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01585:Dbf4 APN 5 8408492 critical splice donor site probably null
IGL02086:Dbf4 APN 5 8403189 missense probably benign 0.09
IGL02582:Dbf4 APN 5 8403172 missense probably benign 0.32
IGL02711:Dbf4 APN 5 8408235 missense probably benign 0.08
PIT4362001:Dbf4 UTSW 5 8403664 missense probably benign 0.00
R1201:Dbf4 UTSW 5 8397498 missense possibly damaging 0.80
R1823:Dbf4 UTSW 5 8397539 missense probably benign 0.00
R1863:Dbf4 UTSW 5 8397375 nonsense probably null
R2237:Dbf4 UTSW 5 8408542 missense possibly damaging 0.51
R2276:Dbf4 UTSW 5 8421333 missense possibly damaging 0.91
R2279:Dbf4 UTSW 5 8421333 missense possibly damaging 0.91
R4774:Dbf4 UTSW 5 8403062 intron probably benign
R4839:Dbf4 UTSW 5 8408263 nonsense probably null
R4932:Dbf4 UTSW 5 8398039 missense probably benign
R6009:Dbf4 UTSW 5 8403718 missense probably damaging 0.99
R6141:Dbf4 UTSW 5 8408545 missense possibly damaging 0.92
R6236:Dbf4 UTSW 5 8398579 intron probably benign
R6583:Dbf4 UTSW 5 8398143 missense probably damaging 0.96
R6663:Dbf4 UTSW 5 8403184 missense probably benign 0.00
R7665:Dbf4 UTSW 5 8397867 missense probably damaging 0.99
R7864:Dbf4 UTSW 5 8410010 missense possibly damaging 0.86
R7898:Dbf4 UTSW 5 8408232 critical splice donor site probably null
R8192:Dbf4 UTSW 5 8398134 missense probably benign 0.00
R8298:Dbf4 UTSW 5 8412115 splice site probably benign
R8475:Dbf4 UTSW 5 8398664 intron probably benign
R8854:Dbf4 UTSW 5 8408562 missense probably damaging 1.00
R8869:Dbf4 UTSW 5 8398656 missense
R9181:Dbf4 UTSW 5 8412206 missense possibly damaging 0.85
R9303:Dbf4 UTSW 5 8398102 missense unknown
R9408:Dbf4 UTSW 5 8397764 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AAACTTGTCCACATGACTGCG -3'
(R):5'- ATAAGATACAGTGTCGGGTCCC -3'

Sequencing Primer
(F):5'- TGGAGCAGGGTCTACTCTC -3'
(R):5'- GATACAGTGTCGGGTCCCTTTCTTC -3'
Posted On 2019-12-04