Incidental Mutation 'RF013:Ccdc121rt2'
ID 603327
Institutional Source Beutler Lab
Gene Symbol Ccdc121rt2
Ensembl Gene ENSMUSG00000072722
Gene Name coiled-coil domain containing 121, retrogene 2
Synonyms Gm6588
Accession Numbers
Essential gene? Probably non essential (E-score: 0.053) question?
Stock # RF013 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 112597292-112599604 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 112597937 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 161 (N161K)
Ref Sequence ENSEMBL: ENSMUSP00000098441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075387] [ENSMUST00000079491] [ENSMUST00000100882] [ENSMUST00000197425] [ENSMUST00000212480] [ENSMUST00000212758]
AlphaFold E9Q3K0
Predicted Effect probably benign
Transcript: ENSMUST00000075387
SMART Domains Protein: ENSMUSP00000074847
Gene: ENSMUSG00000058153

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
CUB 221 329 3.62e-8 SMART
CCP 333 388 1.01e-11 SMART
CUB 392 502 3.75e-15 SMART
CCP 507 564 1.41e-10 SMART
CUB 568 679 4.87e-23 SMART
CCP 685 740 4.95e-15 SMART
CCP 746 805 3.07e-11 SMART
CCP 813 870 8.04e-15 SMART
low complexity region 880 891 N/A INTRINSIC
transmembrane domain 895 917 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079491
SMART Domains Protein: ENSMUSP00000078454
Gene: ENSMUSG00000058153

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
CUB 221 329 3.62e-8 SMART
CCP 333 388 1.01e-11 SMART
CUB 392 502 3.75e-15 SMART
CCP 507 564 1.41e-10 SMART
CUB 568 679 4.87e-23 SMART
CCP 685 740 4.95e-15 SMART
CCP 746 805 3.07e-11 SMART
CCP 813 870 8.04e-15 SMART
low complexity region 878 892 N/A INTRINSIC
transmembrane domain 896 918 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100882
AA Change: N161K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000098441
Gene: ENSMUSG00000072722
AA Change: N161K

DomainStartEndE-ValueType
coiled coil region 159 180 N/A INTRINSIC
Pfam:DUF4515 194 399 9.5e-82 PFAM
low complexity region 403 425 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197425
SMART Domains Protein: ENSMUSP00000143395
Gene: ENSMUSG00000058153

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
CUB 221 329 3.62e-8 SMART
CCP 333 388 1.01e-11 SMART
CUB 392 502 3.75e-15 SMART
CCP 507 564 1.41e-10 SMART
CUB 568 679 4.87e-23 SMART
CCP 685 740 4.95e-15 SMART
CCP 746 805 3.07e-11 SMART
low complexity region 815 826 N/A INTRINSIC
transmembrane domain 830 852 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200575
Predicted Effect probably benign
Transcript: ENSMUST00000212480
Predicted Effect probably benign
Transcript: ENSMUST00000212758
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,989,553 (GRCm39) probably benign Het
Adamts9 A G 6: 92,920,126 (GRCm39) V4A possibly damaging Het
AI837181 GGC GGCTGC 19: 5,475,260 (GRCm39) probably benign Het
Alk A G 17: 72,202,931 (GRCm39) Y1135H probably damaging Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,693,979 (GRCm39) probably benign Het
Ano3 A C 2: 110,527,381 (GRCm39) L609R probably benign Het
Bicc1 A G 10: 70,771,660 (GRCm39) probably null Het
Bltp1 TTAT TTATTATTATTATTAGTAT 3: 37,104,906 (GRCm39) probably benign Het
Card6 T C 15: 5,129,624 (GRCm39) I591V probably benign Het
Ccdc18 A G 5: 108,368,582 (GRCm39) N1235D probably benign Het
Cd109 TTAT TTATTTATTTATCTAT 9: 78,619,813 (GRCm39) probably benign Het
Cnpy3 CCT CCTGCT 17: 47,047,670 (GRCm39) probably benign Het
Col6a5 GCAGTC GCAGTCTCCAGTC 9: 105,755,796 (GRCm39) probably null Het
Cyb5r4 GACACACTGCCCAGGGA GACACACTGCCCAGGGATGTGACACACACACTGCCCAGGGA 9: 86,922,485 (GRCm39) probably benign Het
Cyp8b1 A T 9: 121,744,561 (GRCm39) M257K possibly damaging Het
Dbf4 A T 5: 8,447,985 (GRCm39) H408Q possibly damaging Het
Defb22 TTGCGGCA TTGCGGCAGAGCTGGCCTGTGCGGCA 2: 152,327,751 (GRCm39) probably benign Het
Ercc6l2 A T 13: 64,000,831 (GRCm39) T417S probably benign Het
Exd2 AGCCACAG A 12: 80,522,706 (GRCm39) probably null Het
Fam171b GC GCAGCATC 2: 83,643,239 (GRCm39) probably benign Het
Flvcr2 T A 12: 85,793,960 (GRCm39) L112Q probably damaging Het
Flywch1 GTG GTGGGGGGAGGCTACGTACTCACCCACTCCTTTTG 17: 23,981,149 (GRCm39) probably null Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 71,314,022 (GRCm39) probably benign Het
Garin5a CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGACGGCTGGATCCTGGATCACTGGGTCTGAGGGAGGA 7: 44,149,944 (GRCm39) probably null Het
Gm4884 C A 7: 40,690,233 (GRCm39) P43Q probably damaging Het
Grm8 A G 6: 27,363,779 (GRCm39) W579R probably damaging Het
Hsdl2 AG AGCAGCAGCCACAGCTGCCG 4: 59,610,657 (GRCm39) probably benign Het
Ivl CTGCTGCTGCTGCTGT C 3: 92,479,650 (GRCm39) probably benign Het
Kif18b T C 11: 102,803,192 (GRCm39) D506G probably benign Het
Krtap28-10 AGCCAC AGCCACGGCCAC 1: 83,019,856 (GRCm39) probably benign Het
Krtap28-10 GCCACAGCCACCACA GCCACAGCCACCACATCCACAGCCACCACA 1: 83,019,995 (GRCm39) probably benign Het
Lama1 C A 17: 68,088,057 (GRCm39) S1558R Het
Lcmt1 C CCGCGGGGCTT 7: 122,969,059 (GRCm39) probably null Het
Lmna A G 3: 88,391,361 (GRCm39) V494A probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,295,542 (GRCm39) probably null Het
Mboat7 T A 7: 3,694,856 (GRCm39) H52L probably damaging Het
Med12l CAG CAGAAG 3: 59,183,387 (GRCm39) probably benign Het
Morc2a T A 11: 3,626,191 (GRCm39) M225K probably benign Het
Mpdz G A 4: 81,211,829 (GRCm39) A1566V possibly damaging Het
Mpi T C 9: 57,455,924 (GRCm39) D186G probably benign Het
Mtmr12 C A 15: 12,261,984 (GRCm39) N386K probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 66,977,182 (GRCm39) probably null Het
Myo10 T A 15: 25,799,565 (GRCm39) M1376K probably damaging Het
Nbas C T 12: 13,329,409 (GRCm39) T118I possibly damaging Het
Nedd4l C T 18: 65,342,751 (GRCm39) R755C probably damaging Het
Nefh GACTTGGCCTCACCTGGG GACTTGGCCTCACCTGGGTACTTGGCCTCACCTGGG 11: 4,891,032 (GRCm39) probably benign Het
Numa1 T C 7: 101,648,987 (GRCm39) L906P probably damaging Het
Or6s1 G A 14: 51,308,469 (GRCm39) A127V probably damaging Het
Or7h8 T C 9: 20,124,190 (GRCm39) S182P probably benign Het
Otop2 G T 11: 115,214,492 (GRCm39) R83L probably benign Het
Pmm1 T A 15: 81,842,014 (GRCm39) Q62L probably damaging Het
Pramel16 C G 4: 143,675,478 (GRCm39) Q449H probably damaging Het
Ptprj A T 2: 90,301,514 (GRCm39) L206* probably null Het
Rassf6 TC TCTGCCTCACTCATGGTCCTGTAGAGCATTGGGGATCC 5: 90,756,800 (GRCm39) probably benign Het
Rps19 A AGAAAAT 7: 24,588,605 (GRCm39) probably benign Het
Rsrp1 T A 4: 134,651,266 (GRCm39) V10E unknown Het
Sh2d6 C T 6: 72,493,371 (GRCm39) probably null Het
Six4 TG T 12: 73,150,356 (GRCm39) probably null Het
Slc6a15 T A 10: 103,236,077 (GRCm39) V264D probably damaging Het
Snapc5 ATGGAAGAAGAGG A 9: 64,089,493 (GRCm39) probably benign Het
Sost A T 11: 101,854,958 (GRCm39) I117N probably damaging Het
Spmip5 A G 19: 58,777,726 (GRCm39) F28S probably damaging Het
Tbc1d22a AGGTGTGTG A 15: 86,183,975 (GRCm39) probably null Het
Tcaf1 C T 6: 42,656,107 (GRCm39) V290I probably benign Het
Tcof1 GCA GCACCA 18: 60,968,815 (GRCm39) probably benign Het
Tex55 T C 16: 38,648,363 (GRCm39) T249A probably benign Het
Tgfbr1 A G 4: 47,353,354 (GRCm39) I15V unknown Het
Tmem241 A T 18: 12,116,618 (GRCm39) L288Q probably damaging Het
Tnfrsf13b T G 11: 61,032,270 (GRCm39) V100G probably benign Het
Trim66 A G 7: 109,059,960 (GRCm39) S809P probably damaging Het
Tubb4a C G 17: 57,394,464 (GRCm39) G17A possibly damaging Het
Txndc16 A G 14: 45,406,795 (GRCm39) V220A probably benign Het
Zan T A 5: 137,389,982 (GRCm39) Q4830L unknown Het
Other mutations in Ccdc121rt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02323:Ccdc121rt2 APN 5 112,597,600 (GRCm39) missense probably benign 0.22
R0785:Ccdc121rt2 UTSW 5 112,598,434 (GRCm39) missense probably benign 0.00
R1938:Ccdc121rt2 UTSW 5 112,597,667 (GRCm39) nonsense probably null
R2047:Ccdc121rt2 UTSW 5 112,598,575 (GRCm39) missense probably benign 0.00
R4116:Ccdc121rt2 UTSW 5 112,598,377 (GRCm39) missense probably damaging 0.98
R4608:Ccdc121rt2 UTSW 5 112,597,764 (GRCm39) missense possibly damaging 0.85
R4841:Ccdc121rt2 UTSW 5 112,598,106 (GRCm39) nonsense probably null
R4842:Ccdc121rt2 UTSW 5 112,598,106 (GRCm39) nonsense probably null
R6301:Ccdc121rt2 UTSW 5 112,598,334 (GRCm39) missense possibly damaging 0.47
R6418:Ccdc121rt2 UTSW 5 112,598,019 (GRCm39) missense probably benign 0.05
R7395:Ccdc121rt2 UTSW 5 112,598,035 (GRCm39) missense possibly damaging 0.93
R7799:Ccdc121rt2 UTSW 5 112,597,698 (GRCm39) missense not run
R7991:Ccdc121rt2 UTSW 5 112,598,791 (GRCm39) missense probably benign
R8188:Ccdc121rt2 UTSW 5 112,597,993 (GRCm39) missense possibly damaging 0.62
R8343:Ccdc121rt2 UTSW 5 112,598,653 (GRCm39) missense probably benign 0.01
R8773:Ccdc121rt2 UTSW 5 112,597,681 (GRCm39) missense probably benign 0.00
R8966:Ccdc121rt2 UTSW 5 112,598,103 (GRCm39) missense probably damaging 0.99
R9089:Ccdc121rt2 UTSW 5 112,598,757 (GRCm39) missense probably damaging 0.97
X0062:Ccdc121rt2 UTSW 5 112,598,445 (GRCm39) missense probably benign 0.01
Z1176:Ccdc121rt2 UTSW 5 112,597,741 (GRCm39) missense probably benign
Z1177:Ccdc121rt2 UTSW 5 112,598,827 (GRCm39) frame shift probably null
Z1177:Ccdc121rt2 UTSW 5 112,597,872 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGACGTAAGCTCCTGTTCCTC -3'
(R):5'- GATCTCCTGATACTGCTGGATG -3'

Sequencing Primer
(F):5'- TGTTCCTCAGAGGCTAGCATCAG -3'
(R):5'- ACTGCTGGATGTAATCTTTCCACAGG -3'
Posted On 2019-12-04