Incidental Mutation 'RF013:Tcaf1'
ID 603330
Institutional Source Beutler Lab
Gene Symbol Tcaf1
Ensembl Gene ENSMUSG00000036667
Gene Name TRPM8 channel-associated factor 1
Synonyms 3321401G04Rik, A230020K05Rik, 2810407D09Rik, Fam115a
Accession Numbers
Essential gene? Probably non essential (E-score: 0.090) question?
Stock # RF013 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 42644936-42687022 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 42656107 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 290 (V290I)
Ref Sequence ENSEMBL: ENSMUSP00000046137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045054] [ENSMUST00000045140] [ENSMUST00000121083]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000045054
AA Change: V290I

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000046137
Gene: ENSMUSG00000036667
AA Change: V290I

DomainStartEndE-ValueType
internal_repeat_1 14 197 6.95e-30 PROSPERO
low complexity region 207 221 N/A INTRINSIC
internal_repeat_1 222 406 6.95e-30 PROSPERO
low complexity region 463 474 N/A INTRINSIC
M60-like 542 841 1.94e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000045140
AA Change: V290I

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000036379
Gene: ENSMUSG00000036667
AA Change: V290I

DomainStartEndE-ValueType
internal_repeat_1 14 197 6.95e-30 PROSPERO
low complexity region 207 221 N/A INTRINSIC
internal_repeat_1 222 406 6.95e-30 PROSPERO
low complexity region 463 474 N/A INTRINSIC
M60-like 542 841 1.94e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121083
AA Change: V290I

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000114036
Gene: ENSMUSG00000036667
AA Change: V290I

DomainStartEndE-ValueType
internal_repeat_1 14 197 6.95e-30 PROSPERO
low complexity region 207 221 N/A INTRINSIC
internal_repeat_1 222 406 6.95e-30 PROSPERO
low complexity region 463 474 N/A INTRINSIC
M60-like 542 841 1.94e-128 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,989,553 (GRCm39) probably benign Het
Adamts9 A G 6: 92,920,126 (GRCm39) V4A possibly damaging Het
AI837181 GGC GGCTGC 19: 5,475,260 (GRCm39) probably benign Het
Alk A G 17: 72,202,931 (GRCm39) Y1135H probably damaging Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,693,979 (GRCm39) probably benign Het
Ano3 A C 2: 110,527,381 (GRCm39) L609R probably benign Het
Bicc1 A G 10: 70,771,660 (GRCm39) probably null Het
Bltp1 TTAT TTATTATTATTATTAGTAT 3: 37,104,906 (GRCm39) probably benign Het
Card6 T C 15: 5,129,624 (GRCm39) I591V probably benign Het
Ccdc121rt2 T A 5: 112,597,937 (GRCm39) N161K probably benign Het
Ccdc18 A G 5: 108,368,582 (GRCm39) N1235D probably benign Het
Cd109 TTAT TTATTTATTTATCTAT 9: 78,619,813 (GRCm39) probably benign Het
Cnpy3 CCT CCTGCT 17: 47,047,670 (GRCm39) probably benign Het
Col6a5 GCAGTC GCAGTCTCCAGTC 9: 105,755,796 (GRCm39) probably null Het
Cyb5r4 GACACACTGCCCAGGGA GACACACTGCCCAGGGATGTGACACACACACTGCCCAGGGA 9: 86,922,485 (GRCm39) probably benign Het
Cyp8b1 A T 9: 121,744,561 (GRCm39) M257K possibly damaging Het
Dbf4 A T 5: 8,447,985 (GRCm39) H408Q possibly damaging Het
Defb22 TTGCGGCA TTGCGGCAGAGCTGGCCTGTGCGGCA 2: 152,327,751 (GRCm39) probably benign Het
Ercc6l2 A T 13: 64,000,831 (GRCm39) T417S probably benign Het
Exd2 AGCCACAG A 12: 80,522,706 (GRCm39) probably null Het
Fam171b GC GCAGCATC 2: 83,643,239 (GRCm39) probably benign Het
Flvcr2 T A 12: 85,793,960 (GRCm39) L112Q probably damaging Het
Flywch1 GTG GTGGGGGGAGGCTACGTACTCACCCACTCCTTTTG 17: 23,981,149 (GRCm39) probably null Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 71,314,022 (GRCm39) probably benign Het
Garin5a CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGACGGCTGGATCCTGGATCACTGGGTCTGAGGGAGGA 7: 44,149,944 (GRCm39) probably null Het
Gm4884 C A 7: 40,690,233 (GRCm39) P43Q probably damaging Het
Grm8 A G 6: 27,363,779 (GRCm39) W579R probably damaging Het
Hsdl2 AG AGCAGCAGCCACAGCTGCCG 4: 59,610,657 (GRCm39) probably benign Het
Ivl CTGCTGCTGCTGCTGT C 3: 92,479,650 (GRCm39) probably benign Het
Kif18b T C 11: 102,803,192 (GRCm39) D506G probably benign Het
Krtap28-10 AGCCAC AGCCACGGCCAC 1: 83,019,856 (GRCm39) probably benign Het
Krtap28-10 GCCACAGCCACCACA GCCACAGCCACCACATCCACAGCCACCACA 1: 83,019,995 (GRCm39) probably benign Het
Lama1 C A 17: 68,088,057 (GRCm39) S1558R Het
Lcmt1 C CCGCGGGGCTT 7: 122,969,059 (GRCm39) probably null Het
Lmna A G 3: 88,391,361 (GRCm39) V494A probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,295,542 (GRCm39) probably null Het
Mboat7 T A 7: 3,694,856 (GRCm39) H52L probably damaging Het
Med12l CAG CAGAAG 3: 59,183,387 (GRCm39) probably benign Het
Morc2a T A 11: 3,626,191 (GRCm39) M225K probably benign Het
Mpdz G A 4: 81,211,829 (GRCm39) A1566V possibly damaging Het
Mpi T C 9: 57,455,924 (GRCm39) D186G probably benign Het
Mtmr12 C A 15: 12,261,984 (GRCm39) N386K probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 66,977,182 (GRCm39) probably null Het
Myo10 T A 15: 25,799,565 (GRCm39) M1376K probably damaging Het
Nbas C T 12: 13,329,409 (GRCm39) T118I possibly damaging Het
Nedd4l C T 18: 65,342,751 (GRCm39) R755C probably damaging Het
Nefh GACTTGGCCTCACCTGGG GACTTGGCCTCACCTGGGTACTTGGCCTCACCTGGG 11: 4,891,032 (GRCm39) probably benign Het
Numa1 T C 7: 101,648,987 (GRCm39) L906P probably damaging Het
Or6s1 G A 14: 51,308,469 (GRCm39) A127V probably damaging Het
Or7h8 T C 9: 20,124,190 (GRCm39) S182P probably benign Het
Otop2 G T 11: 115,214,492 (GRCm39) R83L probably benign Het
Pmm1 T A 15: 81,842,014 (GRCm39) Q62L probably damaging Het
Pramel16 C G 4: 143,675,478 (GRCm39) Q449H probably damaging Het
Ptprj A T 2: 90,301,514 (GRCm39) L206* probably null Het
Rassf6 TC TCTGCCTCACTCATGGTCCTGTAGAGCATTGGGGATCC 5: 90,756,800 (GRCm39) probably benign Het
Rps19 A AGAAAAT 7: 24,588,605 (GRCm39) probably benign Het
Rsrp1 T A 4: 134,651,266 (GRCm39) V10E unknown Het
Sh2d6 C T 6: 72,493,371 (GRCm39) probably null Het
Six4 TG T 12: 73,150,356 (GRCm39) probably null Het
Slc6a15 T A 10: 103,236,077 (GRCm39) V264D probably damaging Het
Snapc5 ATGGAAGAAGAGG A 9: 64,089,493 (GRCm39) probably benign Het
Sost A T 11: 101,854,958 (GRCm39) I117N probably damaging Het
Spmip5 A G 19: 58,777,726 (GRCm39) F28S probably damaging Het
Tbc1d22a AGGTGTGTG A 15: 86,183,975 (GRCm39) probably null Het
Tcof1 GCA GCACCA 18: 60,968,815 (GRCm39) probably benign Het
Tex55 T C 16: 38,648,363 (GRCm39) T249A probably benign Het
Tgfbr1 A G 4: 47,353,354 (GRCm39) I15V unknown Het
Tmem241 A T 18: 12,116,618 (GRCm39) L288Q probably damaging Het
Tnfrsf13b T G 11: 61,032,270 (GRCm39) V100G probably benign Het
Trim66 A G 7: 109,059,960 (GRCm39) S809P probably damaging Het
Tubb4a C G 17: 57,394,464 (GRCm39) G17A possibly damaging Het
Txndc16 A G 14: 45,406,795 (GRCm39) V220A probably benign Het
Zan T A 5: 137,389,982 (GRCm39) Q4830L unknown Het
Other mutations in Tcaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Tcaf1 APN 6 42,663,556 (GRCm39) missense probably benign
IGL02415:Tcaf1 APN 6 42,663,584 (GRCm39) missense probably benign 0.00
IGL02504:Tcaf1 APN 6 42,656,213 (GRCm39) missense probably benign 0.05
IGL02960:Tcaf1 APN 6 42,663,393 (GRCm39) missense probably benign
IGL03022:Tcaf1 APN 6 42,655,060 (GRCm39) nonsense probably null
PIT4696001:Tcaf1 UTSW 6 42,655,473 (GRCm39) missense probably benign 0.00
R0103:Tcaf1 UTSW 6 42,663,324 (GRCm39) missense probably benign 0.23
R0103:Tcaf1 UTSW 6 42,663,324 (GRCm39) missense probably benign 0.23
R0586:Tcaf1 UTSW 6 42,650,473 (GRCm39) missense probably damaging 1.00
R0717:Tcaf1 UTSW 6 42,655,599 (GRCm39) missense probably benign 0.01
R0724:Tcaf1 UTSW 6 42,652,301 (GRCm39) missense probably damaging 1.00
R1166:Tcaf1 UTSW 6 42,655,612 (GRCm39) missense probably benign
R1472:Tcaf1 UTSW 6 42,663,382 (GRCm39) missense possibly damaging 0.83
R1538:Tcaf1 UTSW 6 42,655,923 (GRCm39) missense probably damaging 1.00
R1721:Tcaf1 UTSW 6 42,652,272 (GRCm39) missense possibly damaging 0.90
R1776:Tcaf1 UTSW 6 42,655,389 (GRCm39) missense possibly damaging 0.90
R2136:Tcaf1 UTSW 6 42,650,454 (GRCm39) missense probably benign 0.01
R3433:Tcaf1 UTSW 6 42,663,508 (GRCm39) missense probably damaging 0.98
R3951:Tcaf1 UTSW 6 42,655,993 (GRCm39) missense probably benign 0.14
R4472:Tcaf1 UTSW 6 42,656,248 (GRCm39) missense probably benign
R4740:Tcaf1 UTSW 6 42,663,809 (GRCm39) missense probably benign
R4915:Tcaf1 UTSW 6 42,652,130 (GRCm39) missense probably damaging 1.00
R5249:Tcaf1 UTSW 6 42,653,793 (GRCm39) missense probably benign 0.00
R5340:Tcaf1 UTSW 6 42,655,923 (GRCm39) missense probably damaging 1.00
R5458:Tcaf1 UTSW 6 42,663,476 (GRCm39) missense probably benign
R6196:Tcaf1 UTSW 6 42,653,741 (GRCm39) missense probably damaging 1.00
R6772:Tcaf1 UTSW 6 42,652,210 (GRCm39) missense probably damaging 1.00
R7066:Tcaf1 UTSW 6 42,656,111 (GRCm39) missense probably damaging 1.00
R7145:Tcaf1 UTSW 6 42,663,687 (GRCm39) missense probably damaging 1.00
R7204:Tcaf1 UTSW 6 42,651,973 (GRCm39) splice site probably null
R7529:Tcaf1 UTSW 6 42,652,289 (GRCm39) missense probably damaging 1.00
R7554:Tcaf1 UTSW 6 42,654,388 (GRCm39) missense probably benign 0.13
R7813:Tcaf1 UTSW 6 42,650,363 (GRCm39) nonsense probably null
R8191:Tcaf1 UTSW 6 42,652,190 (GRCm39) missense probably damaging 1.00
R8194:Tcaf1 UTSW 6 42,652,236 (GRCm39) missense probably benign 0.06
R8532:Tcaf1 UTSW 6 42,655,065 (GRCm39) missense probably damaging 0.96
R8784:Tcaf1 UTSW 6 42,656,221 (GRCm39) missense probably benign
R8801:Tcaf1 UTSW 6 42,663,742 (GRCm39) missense probably damaging 1.00
R8945:Tcaf1 UTSW 6 42,663,307 (GRCm39) missense probably benign 0.00
R8989:Tcaf1 UTSW 6 42,663,707 (GRCm39) missense probably damaging 1.00
R9076:Tcaf1 UTSW 6 42,654,372 (GRCm39) missense probably benign 0.01
R9260:Tcaf1 UTSW 6 42,663,554 (GRCm39) missense possibly damaging 0.50
R9321:Tcaf1 UTSW 6 42,656,290 (GRCm39) missense probably benign 0.00
R9539:Tcaf1 UTSW 6 42,655,683 (GRCm39) missense probably benign 0.16
R9673:Tcaf1 UTSW 6 42,663,808 (GRCm39) missense probably benign
Z1177:Tcaf1 UTSW 6 42,650,411 (GRCm39) missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- GCTTGAGTTCCAACAAACAGCC -3'
(R):5'- ATCACCAACTCGGACTGCTTC -3'

Sequencing Primer
(F):5'- ACCCTCTGCTACAAACTCCTG -3'
(R):5'- CCCATCCCAGCTACTAGTTCATGG -3'
Posted On 2019-12-04