Incidental Mutation 'RF013:Tcaf1'
ID 603330
Institutional Source Beutler Lab
Gene Symbol Tcaf1
Ensembl Gene ENSMUSG00000036667
Gene Name TRPM8 channel-associated factor 1
Synonyms A230020K05Rik, 2810407D09Rik, Fam115a, 3321401G04Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock # RF013 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 42668002-42710088 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 42679173 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 290 (V290I)
Ref Sequence ENSEMBL: ENSMUSP00000046137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045054] [ENSMUST00000045140] [ENSMUST00000121083]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000045054
AA Change: V290I

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000046137
Gene: ENSMUSG00000036667
AA Change: V290I

DomainStartEndE-ValueType
internal_repeat_1 14 197 6.95e-30 PROSPERO
low complexity region 207 221 N/A INTRINSIC
internal_repeat_1 222 406 6.95e-30 PROSPERO
low complexity region 463 474 N/A INTRINSIC
M60-like 542 841 1.94e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000045140
AA Change: V290I

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000036379
Gene: ENSMUSG00000036667
AA Change: V290I

DomainStartEndE-ValueType
internal_repeat_1 14 197 6.95e-30 PROSPERO
low complexity region 207 221 N/A INTRINSIC
internal_repeat_1 222 406 6.95e-30 PROSPERO
low complexity region 463 474 N/A INTRINSIC
M60-like 542 841 1.94e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121083
AA Change: V290I

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000114036
Gene: ENSMUSG00000036667
AA Change: V290I

DomainStartEndE-ValueType
internal_repeat_1 14 197 6.95e-30 PROSPERO
low complexity region 207 221 N/A INTRINSIC
internal_repeat_1 222 406 6.95e-30 PROSPERO
low complexity region 463 474 N/A INTRINSIC
M60-like 542 841 1.94e-128 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A G 19: 58,789,294 F28S probably damaging Het
4930435E12Rik T C 16: 38,828,001 T249A probably benign Het
4932438A13Rik TTAT TTATTATTATTATTAGTAT 3: 37,050,757 probably benign Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,905,096 probably benign Het
Adamts9 A G 6: 92,943,145 V4A possibly damaging Het
AI837181 GGC GGCTGC 19: 5,425,232 probably benign Het
Alk A G 17: 71,895,936 Y1135H probably damaging Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,560,926 probably benign Het
Ano3 A C 2: 110,697,036 L609R probably benign Het
Bicc1 A G 10: 70,935,830 probably null Het
Card6 T C 15: 5,100,142 I591V probably benign Het
Ccdc18 A G 5: 108,220,716 N1235D probably benign Het
Cd109 TTAT TTATTTATTTATCTAT 9: 78,712,531 probably benign Het
Cnpy3 CCT CCTGCT 17: 46,736,744 probably benign Het
Col6a5 GCAGTC GCAGTCTCCAGTC 9: 105,878,597 probably null Het
Cyb5r4 GACACACTGCCCAGGGA GACACACTGCCCAGGGATGTGACACACACACTGCCCAGGGA 9: 87,040,432 probably benign Het
Cyp8b1 A T 9: 121,915,495 M257K possibly damaging Het
Dbf4 A T 5: 8,397,985 H408Q possibly damaging Het
Defb22 TTGCGGCA TTGCGGCAGAGCTGGCCTGTGCGGCA 2: 152,485,831 probably benign Het
Ercc6l2 A T 13: 63,853,017 T417S probably benign Het
Exd2 AGCCACAG A 12: 80,475,932 probably null Het
Fam171b GC GCAGCATC 2: 83,812,895 probably benign Het
Fam71e1 CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGACGGCTGGATCCTGGATCACTGGGTCTGAGGGAGGA 7: 44,500,520 probably null Het
Flvcr2 T A 12: 85,747,186 L112Q probably damaging Het
Flywch1 GTG GTGGGGGGAGGCTACGTACTCACCCACTCCTTTTG 17: 23,762,175 probably null Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 72,270,416 probably benign Het
Gm4884 C A 7: 41,040,809 P43Q probably damaging Het
Gm6588 T A 5: 112,450,071 N161K probably benign Het
Grm8 A G 6: 27,363,780 W579R probably damaging Het
Hsdl2 AG AGCAGCAGCCACAGCTGCCG 4: 59,610,657 probably benign Het
Ivl CTGCTGCTGCTGCTGT C 3: 92,572,343 probably benign Het
Kif18b T C 11: 102,912,366 D506G probably benign Het
Krtap28-10 AGCCAC AGCCACGGCCAC 1: 83,042,135 probably benign Het
Krtap28-10 GCCACAGCCACCACA GCCACAGCCACCACATCCACAGCCACCACA 1: 83,042,274 probably benign Het
Lama1 C A 17: 67,781,062 S1558R Het
Lcmt1 C CCGCGGGGCTT 7: 123,369,836 probably null Het
Lmna A G 3: 88,484,054 V494A probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,388,260 probably null Het
Mboat7 T A 7: 3,691,857 H52L probably damaging Het
Med12l CAG CAGAAG 3: 59,275,966 probably benign Het
Morc2a T A 11: 3,676,191 M225K probably benign Het
Mpdz G A 4: 81,293,592 A1566V possibly damaging Het
Mpi T C 9: 57,548,641 D186G probably benign Het
Mtmr12 C A 15: 12,261,898 N386K probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myo10 T A 15: 25,799,479 M1376K probably damaging Het
Nbas C T 12: 13,279,408 T118I possibly damaging Het
Nedd4l C T 18: 65,209,680 R755C probably damaging Het
Nefh GACTTGGCCTCACCTGGG GACTTGGCCTCACCTGGGTACTTGGCCTCACCTGGG 11: 4,941,032 probably benign Het
Numa1 T C 7: 101,999,780 L906P probably damaging Het
Olfr750 G A 14: 51,071,012 A127V probably damaging Het
Olfr871 T C 9: 20,212,894 S182P probably benign Het
Otop2 G T 11: 115,323,666 R83L probably benign Het
Pmm1 T A 15: 81,957,813 Q62L probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Ptprj A T 2: 90,471,170 L206* probably null Het
Rassf6 TC TCTGCCTCACTCATGGTCCTGTAGAGCATTGGGGATCC 5: 90,608,941 probably benign Het
Rps19 A AGAAAAT 7: 24,889,180 probably benign Het
Rsrp1 T A 4: 134,923,955 V10E unknown Het
Sh2d6 C T 6: 72,516,388 probably null Het
Six4 TG T 12: 73,103,582 probably null Het
Slc6a15 T A 10: 103,400,216 V264D probably damaging Het
Snapc5 ATGGAAGAAGAGG A 9: 64,182,211 probably benign Het
Sost A T 11: 101,964,132 I117N probably damaging Het
Tbc1d22a AGGTGTGTG A 15: 86,299,774 probably null Het
Tcof1 GCA GCACCA 18: 60,835,743 probably benign Het
Tgfbr1 A G 4: 47,353,354 I15V unknown Het
Tmem241 A T 18: 11,983,561 L288Q probably damaging Het
Tnfrsf13b T G 11: 61,141,444 V100G probably benign Het
Trim66 A G 7: 109,460,753 S809P probably damaging Het
Tubb4a C G 17: 57,087,464 G17A possibly damaging Het
Txndc16 A G 14: 45,169,338 V220A probably benign Het
Zan T A 5: 137,391,720 Q4830L unknown Het
Other mutations in Tcaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Tcaf1 APN 6 42686622 missense probably benign
IGL02415:Tcaf1 APN 6 42686650 missense probably benign 0.00
IGL02504:Tcaf1 APN 6 42679279 missense probably benign 0.05
IGL02960:Tcaf1 APN 6 42686459 missense probably benign
IGL03022:Tcaf1 APN 6 42678126 nonsense probably null
PIT4696001:Tcaf1 UTSW 6 42678539 missense probably benign 0.00
R0103:Tcaf1 UTSW 6 42686390 missense probably benign 0.23
R0103:Tcaf1 UTSW 6 42686390 missense probably benign 0.23
R0586:Tcaf1 UTSW 6 42673539 missense probably damaging 1.00
R0717:Tcaf1 UTSW 6 42678665 missense probably benign 0.01
R0724:Tcaf1 UTSW 6 42675367 missense probably damaging 1.00
R1166:Tcaf1 UTSW 6 42678678 missense probably benign
R1472:Tcaf1 UTSW 6 42686448 missense possibly damaging 0.83
R1538:Tcaf1 UTSW 6 42678989 missense probably damaging 1.00
R1721:Tcaf1 UTSW 6 42675338 missense possibly damaging 0.90
R1776:Tcaf1 UTSW 6 42678455 missense possibly damaging 0.90
R2136:Tcaf1 UTSW 6 42673520 missense probably benign 0.01
R3433:Tcaf1 UTSW 6 42686574 missense probably damaging 0.98
R3951:Tcaf1 UTSW 6 42679059 missense probably benign 0.14
R4472:Tcaf1 UTSW 6 42679314 missense probably benign
R4740:Tcaf1 UTSW 6 42686875 missense probably benign
R4915:Tcaf1 UTSW 6 42675196 missense probably damaging 1.00
R5249:Tcaf1 UTSW 6 42676859 missense probably benign 0.00
R5340:Tcaf1 UTSW 6 42678989 missense probably damaging 1.00
R5458:Tcaf1 UTSW 6 42686542 missense probably benign
R6196:Tcaf1 UTSW 6 42676807 missense probably damaging 1.00
R6772:Tcaf1 UTSW 6 42675276 missense probably damaging 1.00
R7066:Tcaf1 UTSW 6 42679177 missense probably damaging 1.00
R7145:Tcaf1 UTSW 6 42686753 missense probably damaging 1.00
R7204:Tcaf1 UTSW 6 42675039 splice site probably null
R7529:Tcaf1 UTSW 6 42675355 missense probably damaging 1.00
R7554:Tcaf1 UTSW 6 42677454 missense probably benign 0.13
R7813:Tcaf1 UTSW 6 42673429 nonsense probably null
R8191:Tcaf1 UTSW 6 42675256 missense probably damaging 1.00
R8194:Tcaf1 UTSW 6 42675302 missense probably benign 0.06
R8532:Tcaf1 UTSW 6 42678131 missense probably damaging 0.96
R8784:Tcaf1 UTSW 6 42679287 missense probably benign
R8801:Tcaf1 UTSW 6 42686808 missense probably damaging 1.00
R8945:Tcaf1 UTSW 6 42686373 missense probably benign 0.00
R8989:Tcaf1 UTSW 6 42686773 missense probably damaging 1.00
R9076:Tcaf1 UTSW 6 42677438 missense probably benign 0.01
R9260:Tcaf1 UTSW 6 42686620 missense possibly damaging 0.50
R9321:Tcaf1 UTSW 6 42679356 missense probably benign 0.00
R9539:Tcaf1 UTSW 6 42678749 missense probably benign 0.16
R9673:Tcaf1 UTSW 6 42686874 missense probably benign
Z1177:Tcaf1 UTSW 6 42673477 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- GCTTGAGTTCCAACAAACAGCC -3'
(R):5'- ATCACCAACTCGGACTGCTTC -3'

Sequencing Primer
(F):5'- ACCCTCTGCTACAAACTCCTG -3'
(R):5'- CCCATCCCAGCTACTAGTTCATGG -3'
Posted On 2019-12-04