Incidental Mutation 'RF013:Adamts9'
ID 603332
Institutional Source Beutler Lab
Gene Symbol Adamts9
Ensembl Gene ENSMUSG00000030022
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 9
Synonyms Mhdaund3, Mhdaund4, 1810011L16Rik, 8430403M15Rik, E030027K14Rik, Gsfund3, UND3, UND4
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # RF013 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 92749680-92920473 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 92920126 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 4 (V4A)
Ref Sequence ENSEMBL: ENSMUSP00000109065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113438]
AlphaFold E9PUN6
Predicted Effect possibly damaging
Transcript: ENSMUST00000113438
AA Change: V4A

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109065
Gene: ENSMUSG00000030022
AA Change: V4A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 49 207 1.8e-37 PFAM
low complexity region 234 247 N/A INTRINSIC
Pfam:Reprolysin_5 291 476 7.6e-17 PFAM
Pfam:Reprolysin_4 291 495 2e-11 PFAM
Pfam:Reprolysin 293 499 7.4e-29 PFAM
Pfam:Reprolysin_2 310 489 1e-13 PFAM
Pfam:Reprolysin_3 314 445 1.7e-14 PFAM
TSP1 591 643 2.15e-9 SMART
Pfam:ADAM_spacer1 753 871 7.3e-35 PFAM
TSP1 881 936 1.14e0 SMART
Blast:TSP1 938 993 2e-28 BLAST
TSP1 1000 1054 3.78e-5 SMART
TSP1 1055 1109 5.64e-4 SMART
TSP1 1110 1166 1.25e-5 SMART
TSP1 1186 1240 1.45e-6 SMART
TSP1 1242 1296 4.41e-6 SMART
TSP1 1328 1380 7.06e-5 SMART
TSP1 1381 1436 4.24e-8 SMART
TSP1 1440 1495 8.23e-6 SMART
TSP1 1496 1551 1.23e-4 SMART
TSP1 1552 1609 2e-4 SMART
TSP1 1611 1672 1.25e-5 SMART
TSP1 1676 1730 3.47e-4 SMART
Pfam:GON 1732 1930 1.6e-85 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. Members of the ADAMTS family have been implicated in the cleavage of proteoglycans, the control of organ shape during development, and the inhibition of angiogenesis. This gene is localized to chromosome 3p14.3-p14.2, an area known to be lost in hereditary renal tumors. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,989,553 (GRCm39) probably benign Het
AI837181 GGC GGCTGC 19: 5,475,260 (GRCm39) probably benign Het
Alk A G 17: 72,202,931 (GRCm39) Y1135H probably damaging Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,693,979 (GRCm39) probably benign Het
Ano3 A C 2: 110,527,381 (GRCm39) L609R probably benign Het
Bicc1 A G 10: 70,771,660 (GRCm39) probably null Het
Bltp1 TTAT TTATTATTATTATTAGTAT 3: 37,104,906 (GRCm39) probably benign Het
Card6 T C 15: 5,129,624 (GRCm39) I591V probably benign Het
Ccdc121rt2 T A 5: 112,597,937 (GRCm39) N161K probably benign Het
Ccdc18 A G 5: 108,368,582 (GRCm39) N1235D probably benign Het
Cd109 TTAT TTATTTATTTATCTAT 9: 78,619,813 (GRCm39) probably benign Het
Cnpy3 CCT CCTGCT 17: 47,047,670 (GRCm39) probably benign Het
Col6a5 GCAGTC GCAGTCTCCAGTC 9: 105,755,796 (GRCm39) probably null Het
Cyb5r4 GACACACTGCCCAGGGA GACACACTGCCCAGGGATGTGACACACACACTGCCCAGGGA 9: 86,922,485 (GRCm39) probably benign Het
Cyp8b1 A T 9: 121,744,561 (GRCm39) M257K possibly damaging Het
Dbf4 A T 5: 8,447,985 (GRCm39) H408Q possibly damaging Het
Defb22 TTGCGGCA TTGCGGCAGAGCTGGCCTGTGCGGCA 2: 152,327,751 (GRCm39) probably benign Het
Ercc6l2 A T 13: 64,000,831 (GRCm39) T417S probably benign Het
Exd2 AGCCACAG A 12: 80,522,706 (GRCm39) probably null Het
Fam171b GC GCAGCATC 2: 83,643,239 (GRCm39) probably benign Het
Flvcr2 T A 12: 85,793,960 (GRCm39) L112Q probably damaging Het
Flywch1 GTG GTGGGGGGAGGCTACGTACTCACCCACTCCTTTTG 17: 23,981,149 (GRCm39) probably null Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 71,314,022 (GRCm39) probably benign Het
Garin5a CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGACGGCTGGATCCTGGATCACTGGGTCTGAGGGAGGA 7: 44,149,944 (GRCm39) probably null Het
Gm4884 C A 7: 40,690,233 (GRCm39) P43Q probably damaging Het
Grm8 A G 6: 27,363,779 (GRCm39) W579R probably damaging Het
Hsdl2 AG AGCAGCAGCCACAGCTGCCG 4: 59,610,657 (GRCm39) probably benign Het
Ivl CTGCTGCTGCTGCTGT C 3: 92,479,650 (GRCm39) probably benign Het
Kif18b T C 11: 102,803,192 (GRCm39) D506G probably benign Het
Krtap28-10 AGCCAC AGCCACGGCCAC 1: 83,019,856 (GRCm39) probably benign Het
Krtap28-10 GCCACAGCCACCACA GCCACAGCCACCACATCCACAGCCACCACA 1: 83,019,995 (GRCm39) probably benign Het
Lama1 C A 17: 68,088,057 (GRCm39) S1558R Het
Lcmt1 C CCGCGGGGCTT 7: 122,969,059 (GRCm39) probably null Het
Lmna A G 3: 88,391,361 (GRCm39) V494A probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,295,542 (GRCm39) probably null Het
Mboat7 T A 7: 3,694,856 (GRCm39) H52L probably damaging Het
Med12l CAG CAGAAG 3: 59,183,387 (GRCm39) probably benign Het
Morc2a T A 11: 3,626,191 (GRCm39) M225K probably benign Het
Mpdz G A 4: 81,211,829 (GRCm39) A1566V possibly damaging Het
Mpi T C 9: 57,455,924 (GRCm39) D186G probably benign Het
Mtmr12 C A 15: 12,261,984 (GRCm39) N386K probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 66,977,182 (GRCm39) probably null Het
Myo10 T A 15: 25,799,565 (GRCm39) M1376K probably damaging Het
Nbas C T 12: 13,329,409 (GRCm39) T118I possibly damaging Het
Nedd4l C T 18: 65,342,751 (GRCm39) R755C probably damaging Het
Nefh GACTTGGCCTCACCTGGG GACTTGGCCTCACCTGGGTACTTGGCCTCACCTGGG 11: 4,891,032 (GRCm39) probably benign Het
Numa1 T C 7: 101,648,987 (GRCm39) L906P probably damaging Het
Or6s1 G A 14: 51,308,469 (GRCm39) A127V probably damaging Het
Or7h8 T C 9: 20,124,190 (GRCm39) S182P probably benign Het
Otop2 G T 11: 115,214,492 (GRCm39) R83L probably benign Het
Pmm1 T A 15: 81,842,014 (GRCm39) Q62L probably damaging Het
Pramel16 C G 4: 143,675,478 (GRCm39) Q449H probably damaging Het
Ptprj A T 2: 90,301,514 (GRCm39) L206* probably null Het
Rassf6 TC TCTGCCTCACTCATGGTCCTGTAGAGCATTGGGGATCC 5: 90,756,800 (GRCm39) probably benign Het
Rps19 A AGAAAAT 7: 24,588,605 (GRCm39) probably benign Het
Rsrp1 T A 4: 134,651,266 (GRCm39) V10E unknown Het
Sh2d6 C T 6: 72,493,371 (GRCm39) probably null Het
Six4 TG T 12: 73,150,356 (GRCm39) probably null Het
Slc6a15 T A 10: 103,236,077 (GRCm39) V264D probably damaging Het
Snapc5 ATGGAAGAAGAGG A 9: 64,089,493 (GRCm39) probably benign Het
Sost A T 11: 101,854,958 (GRCm39) I117N probably damaging Het
Spmip5 A G 19: 58,777,726 (GRCm39) F28S probably damaging Het
Tbc1d22a AGGTGTGTG A 15: 86,183,975 (GRCm39) probably null Het
Tcaf1 C T 6: 42,656,107 (GRCm39) V290I probably benign Het
Tcof1 GCA GCACCA 18: 60,968,815 (GRCm39) probably benign Het
Tex55 T C 16: 38,648,363 (GRCm39) T249A probably benign Het
Tgfbr1 A G 4: 47,353,354 (GRCm39) I15V unknown Het
Tmem241 A T 18: 12,116,618 (GRCm39) L288Q probably damaging Het
Tnfrsf13b T G 11: 61,032,270 (GRCm39) V100G probably benign Het
Trim66 A G 7: 109,059,960 (GRCm39) S809P probably damaging Het
Tubb4a C G 17: 57,394,464 (GRCm39) G17A possibly damaging Het
Txndc16 A G 14: 45,406,795 (GRCm39) V220A probably benign Het
Zan T A 5: 137,389,982 (GRCm39) Q4830L unknown Het
Other mutations in Adamts9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Adamts9 APN 6 92,836,883 (GRCm39) missense possibly damaging 0.90
IGL01352:Adamts9 APN 6 92,837,155 (GRCm39) missense probably benign 0.00
IGL01462:Adamts9 APN 6 92,871,247 (GRCm39) missense probably benign 0.04
IGL01551:Adamts9 APN 6 92,784,001 (GRCm39) missense probably damaging 0.99
IGL01577:Adamts9 APN 6 92,835,128 (GRCm39) splice site probably benign
IGL01638:Adamts9 APN 6 92,849,409 (GRCm39) missense probably benign 0.19
IGL01757:Adamts9 APN 6 92,773,140 (GRCm39) missense probably damaging 1.00
IGL02102:Adamts9 APN 6 92,754,420 (GRCm39) missense probably benign 0.00
IGL02379:Adamts9 APN 6 92,774,014 (GRCm39) missense probably damaging 0.97
IGL02419:Adamts9 APN 6 92,773,978 (GRCm39) missense probably benign 0.04
IGL02554:Adamts9 APN 6 92,857,828 (GRCm39) missense probably benign 0.01
IGL02832:Adamts9 APN 6 92,784,156 (GRCm39) missense probably damaging 1.00
IGL03164:Adamts9 APN 6 92,866,918 (GRCm39) missense probably damaging 1.00
IGL03347:Adamts9 APN 6 92,864,413 (GRCm39) nonsense probably null
IGL03401:Adamts9 APN 6 92,763,849 (GRCm39) missense probably damaging 0.97
basilisk UTSW 6 92,837,170 (GRCm39) missense probably benign 0.35
bluebeard UTSW 6 92,856,940 (GRCm39) nonsense probably null
Serpent UTSW 6 92,885,687 (GRCm39) missense probably damaging 1.00
PIT4402001:Adamts9 UTSW 6 92,849,328 (GRCm39) missense probably benign
PIT4458001:Adamts9 UTSW 6 92,866,886 (GRCm39) missense probably damaging 0.99
R0047:Adamts9 UTSW 6 92,882,287 (GRCm39) unclassified probably benign
R0047:Adamts9 UTSW 6 92,882,287 (GRCm39) unclassified probably benign
R0067:Adamts9 UTSW 6 92,867,148 (GRCm39) missense probably damaging 0.98
R0141:Adamts9 UTSW 6 92,920,066 (GRCm39) missense probably benign
R0326:Adamts9 UTSW 6 92,835,038 (GRCm39) nonsense probably null
R0396:Adamts9 UTSW 6 92,774,986 (GRCm39) missense probably benign 0.00
R0490:Adamts9 UTSW 6 92,849,847 (GRCm39) missense probably benign
R0504:Adamts9 UTSW 6 92,889,626 (GRCm39) missense probably damaging 1.00
R0620:Adamts9 UTSW 6 92,835,094 (GRCm39) missense possibly damaging 0.95
R0669:Adamts9 UTSW 6 92,857,938 (GRCm39) missense probably damaging 1.00
R0682:Adamts9 UTSW 6 92,880,783 (GRCm39) missense possibly damaging 0.80
R1412:Adamts9 UTSW 6 92,773,414 (GRCm39) missense probably benign
R1433:Adamts9 UTSW 6 92,826,271 (GRCm39) critical splice donor site probably null
R1558:Adamts9 UTSW 6 92,885,692 (GRCm39) missense possibly damaging 0.87
R1661:Adamts9 UTSW 6 92,857,604 (GRCm39) missense possibly damaging 0.92
R1801:Adamts9 UTSW 6 92,840,357 (GRCm39) missense probably benign 0.27
R1855:Adamts9 UTSW 6 92,878,350 (GRCm39) splice site probably benign
R1887:Adamts9 UTSW 6 92,849,769 (GRCm39) critical splice donor site probably null
R1934:Adamts9 UTSW 6 92,920,102 (GRCm39) missense possibly damaging 0.59
R1956:Adamts9 UTSW 6 92,836,830 (GRCm39) missense probably damaging 1.00
R1986:Adamts9 UTSW 6 92,773,375 (GRCm39) missense probably benign
R2370:Adamts9 UTSW 6 92,837,184 (GRCm39) missense probably damaging 0.99
R2376:Adamts9 UTSW 6 92,889,812 (GRCm39) missense probably benign
R2432:Adamts9 UTSW 6 92,834,881 (GRCm39) missense probably damaging 1.00
R2876:Adamts9 UTSW 6 92,772,891 (GRCm39) splice site probably benign
R3015:Adamts9 UTSW 6 92,849,913 (GRCm39) missense probably benign 0.05
R3611:Adamts9 UTSW 6 92,846,965 (GRCm39) missense probably benign 0.05
R4024:Adamts9 UTSW 6 92,849,765 (GRCm39) splice site probably benign
R4292:Adamts9 UTSW 6 92,772,977 (GRCm39) missense possibly damaging 0.95
R4403:Adamts9 UTSW 6 92,836,845 (GRCm39) missense probably damaging 1.00
R4574:Adamts9 UTSW 6 92,856,940 (GRCm39) nonsense probably null
R4677:Adamts9 UTSW 6 92,793,587 (GRCm39) start codon destroyed probably null
R5114:Adamts9 UTSW 6 92,867,254 (GRCm39) missense probably benign 0.03
R5260:Adamts9 UTSW 6 92,784,118 (GRCm39) missense probably benign 0.00
R5384:Adamts9 UTSW 6 92,774,999 (GRCm39) missense probably damaging 1.00
R5423:Adamts9 UTSW 6 92,857,678 (GRCm39) missense possibly damaging 0.84
R5497:Adamts9 UTSW 6 92,831,346 (GRCm39) missense probably damaging 1.00
R5629:Adamts9 UTSW 6 92,775,114 (GRCm39) missense probably damaging 1.00
R5943:Adamts9 UTSW 6 92,880,767 (GRCm39) missense probably benign 0.02
R6039:Adamts9 UTSW 6 92,885,527 (GRCm39) missense possibly damaging 0.95
R6039:Adamts9 UTSW 6 92,885,527 (GRCm39) missense possibly damaging 0.95
R6051:Adamts9 UTSW 6 92,867,099 (GRCm39) missense probably damaging 1.00
R6051:Adamts9 UTSW 6 92,836,907 (GRCm39) missense possibly damaging 0.83
R6082:Adamts9 UTSW 6 92,866,930 (GRCm39) missense probably damaging 1.00
R6192:Adamts9 UTSW 6 92,774,002 (GRCm39) missense probably damaging 1.00
R6291:Adamts9 UTSW 6 92,867,101 (GRCm39) missense probably damaging 1.00
R6502:Adamts9 UTSW 6 92,849,316 (GRCm39) missense probably damaging 1.00
R6818:Adamts9 UTSW 6 92,882,172 (GRCm39) missense probably damaging 1.00
R6848:Adamts9 UTSW 6 92,840,335 (GRCm39) missense possibly damaging 0.84
R7028:Adamts9 UTSW 6 92,886,774 (GRCm39) nonsense probably null
R7095:Adamts9 UTSW 6 92,864,672 (GRCm39) missense probably benign 0.39
R7287:Adamts9 UTSW 6 92,866,984 (GRCm39) missense possibly damaging 0.89
R7294:Adamts9 UTSW 6 92,871,270 (GRCm39) missense probably damaging 1.00
R7313:Adamts9 UTSW 6 92,835,102 (GRCm39) missense probably damaging 1.00
R7581:Adamts9 UTSW 6 92,914,319 (GRCm39) missense probably benign 0.00
R7682:Adamts9 UTSW 6 92,857,679 (GRCm39) missense possibly damaging 0.57
R7691:Adamts9 UTSW 6 92,773,219 (GRCm39) missense probably damaging 1.00
R7791:Adamts9 UTSW 6 92,849,366 (GRCm39) missense probably benign 0.00
R7851:Adamts9 UTSW 6 92,885,687 (GRCm39) missense probably damaging 1.00
R7974:Adamts9 UTSW 6 92,886,668 (GRCm39) critical splice donor site probably null
R8224:Adamts9 UTSW 6 92,773,351 (GRCm39) missense probably damaging 0.96
R8328:Adamts9 UTSW 6 92,866,993 (GRCm39) missense probably benign 0.17
R8334:Adamts9 UTSW 6 92,914,225 (GRCm39) splice site probably null
R8559:Adamts9 UTSW 6 92,784,117 (GRCm39) missense probably benign 0.01
R8709:Adamts9 UTSW 6 92,784,144 (GRCm39) missense probably damaging 1.00
R8735:Adamts9 UTSW 6 92,837,048 (GRCm39) intron probably benign
R8739:Adamts9 UTSW 6 92,831,261 (GRCm39) missense probably benign 0.04
R9108:Adamts9 UTSW 6 92,857,721 (GRCm39) missense probably damaging 1.00
R9171:Adamts9 UTSW 6 92,849,381 (GRCm39) missense probably benign 0.03
R9198:Adamts9 UTSW 6 92,837,170 (GRCm39) missense probably benign 0.35
R9299:Adamts9 UTSW 6 92,773,976 (GRCm39) missense probably benign 0.00
R9300:Adamts9 UTSW 6 92,864,371 (GRCm39) missense probably benign 0.10
R9308:Adamts9 UTSW 6 92,857,875 (GRCm39) missense probably benign 0.03
R9325:Adamts9 UTSW 6 92,849,279 (GRCm39) missense probably benign 0.00
R9397:Adamts9 UTSW 6 92,878,444 (GRCm39) missense probably damaging 1.00
R9550:Adamts9 UTSW 6 92,878,429 (GRCm39) missense probably benign 0.00
R9623:Adamts9 UTSW 6 92,857,661 (GRCm39) missense probably benign 0.02
R9698:Adamts9 UTSW 6 92,784,121 (GRCm39) missense probably damaging 1.00
R9755:Adamts9 UTSW 6 92,856,922 (GRCm39) missense probably benign 0.15
Z1177:Adamts9 UTSW 6 92,831,327 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCGTGTTCAAGAAGGTGGC -3'
(R):5'- TAACTCAGCCAGCAAAGGG -3'

Sequencing Primer
(F):5'- TGTTCAAGAAGGTGGCGATGG -3'
(R):5'- TGGACATTATGCGGCCGAG -3'
Posted On 2019-12-04