Incidental Mutation 'RF013:Mboat7'
ID 603333
Institutional Source Beutler Lab
Gene Symbol Mboat7
Ensembl Gene ENSMUSG00000035596
Gene Name membrane bound O-acyltransferase domain containing 7
Synonyms Leng4, mBB1, Lpiat1, 5730589L02Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.733) question?
Stock # RF013 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 3677789-3693523 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 3691857 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 52 (H52L)
Ref Sequence ENSEMBL: ENSMUSP00000037107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038521] [ENSMUST00000038608] [ENSMUST00000108627] [ENSMUST00000108629] [ENSMUST00000108630] [ENSMUST00000118710] [ENSMUST00000123088] [ENSMUST00000127106] [ENSMUST00000128364] [ENSMUST00000137204] [ENSMUST00000142713] [ENSMUST00000155060] [ENSMUST00000205287] [ENSMUST00000205734] [ENSMUST00000206343] [ENSMUST00000206379] [ENSMUST00000206571]
AlphaFold Q8CHK3
Predicted Effect probably benign
Transcript: ENSMUST00000038521
SMART Domains Protein: ENSMUSP00000046911
Gene: ENSMUSG00000035585

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Pfam:tRNA_int_endo 219 303 2.9e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000038608
AA Change: H52L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037107
Gene: ENSMUSG00000035596
AA Change: H52L

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
Pfam:MBOAT 57 420 2.4e-37 PFAM
transmembrane domain 425 447 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108627
SMART Domains Protein: ENSMUSP00000104267
Gene: ENSMUSG00000035585

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Pfam:tRNA_int_endo 223 307 4.8e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108629
SMART Domains Protein: ENSMUSP00000104269
Gene: ENSMUSG00000035585

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Pfam:tRNA_int_endo 223 256 3.7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108630
SMART Domains Protein: ENSMUSP00000104270
Gene: ENSMUSG00000035585

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Pfam:tRNA_int_endo 223 307 7.9e-24 PFAM
Predicted Effect silent
Transcript: ENSMUST00000118710
SMART Domains Protein: ENSMUSP00000112710
Gene: ENSMUSG00000035596

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
transmembrane domain 35 57 N/A INTRINSIC
Pfam:MBOAT 86 343 1.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123088
SMART Domains Protein: ENSMUSP00000123614
Gene: ENSMUSG00000035585

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000127106
AA Change: H52L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116446
Gene: ENSMUSG00000035596
AA Change: H52L

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000128364
AA Change: H4L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120521
Gene: ENSMUSG00000035596
AA Change: H4L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 32 46 N/A INTRINSIC
low complexity region 58 67 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137204
SMART Domains Protein: ENSMUSP00000120403
Gene: ENSMUSG00000035585

DomainStartEndE-ValueType
low complexity region 69 85 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142713
SMART Domains Protein: ENSMUSP00000118440
Gene: ENSMUSG00000035585

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147288
Predicted Effect probably benign
Transcript: ENSMUST00000155060
SMART Domains Protein: ENSMUSP00000118816
Gene: ENSMUSG00000035585

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205287
Predicted Effect probably benign
Transcript: ENSMUST00000205734
Predicted Effect silent
Transcript: ENSMUST00000206343
Predicted Effect probably damaging
Transcript: ENSMUST00000206379
AA Change: H52L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206571
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-bound O-acyltransferases family of integral membrane proteins that have acyltransferase activity. The encoded protein is a lysophosphatidylinositol acyltransferase that has specificity for arachidonoyl-CoA as an acyl donor. This protein is involved in the reacylation of phospholipids as part of the phospholipid remodeling pathway known as the Land cycle. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit hydrocephaly and most die between 1-3 months of age. Mice homozygous for a knock-out allele exhibit partial lethality with decreased body size, decreased forebrain size, delayed neuronal migrationand reduced neurite outgrowth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A G 19: 58,789,294 F28S probably damaging Het
4930435E12Rik T C 16: 38,828,001 T249A probably benign Het
4932438A13Rik TTAT TTATTATTATTATTAGTAT 3: 37,050,757 probably benign Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,905,096 probably benign Het
Adamts9 A G 6: 92,943,145 V4A possibly damaging Het
AI837181 GGC GGCTGC 19: 5,425,232 probably benign Het
Alk A G 17: 71,895,936 Y1135H probably damaging Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,560,926 probably benign Het
Ano3 A C 2: 110,697,036 L609R probably benign Het
Bicc1 A G 10: 70,935,830 probably null Het
Card6 T C 15: 5,100,142 I591V probably benign Het
Ccdc18 A G 5: 108,220,716 N1235D probably benign Het
Cd109 TTAT TTATTTATTTATCTAT 9: 78,712,531 probably benign Het
Cnpy3 CCT CCTGCT 17: 46,736,744 probably benign Het
Col6a5 GCAGTC GCAGTCTCCAGTC 9: 105,878,597 probably null Het
Cyb5r4 GACACACTGCCCAGGGA GACACACTGCCCAGGGATGTGACACACACACTGCCCAGGGA 9: 87,040,432 probably benign Het
Cyp8b1 A T 9: 121,915,495 M257K possibly damaging Het
Dbf4 A T 5: 8,397,985 H408Q possibly damaging Het
Defb22 TTGCGGCA TTGCGGCAGAGCTGGCCTGTGCGGCA 2: 152,485,831 probably benign Het
Ercc6l2 A T 13: 63,853,017 T417S probably benign Het
Exd2 AGCCACAG A 12: 80,475,932 probably null Het
Fam171b GC GCAGCATC 2: 83,812,895 probably benign Het
Fam71e1 CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGACGGCTGGATCCTGGATCACTGGGTCTGAGGGAGGA 7: 44,500,520 probably null Het
Flvcr2 T A 12: 85,747,186 L112Q probably damaging Het
Flywch1 GTG GTGGGGGGAGGCTACGTACTCACCCACTCCTTTTG 17: 23,762,175 probably null Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 72,270,416 probably benign Het
Gm4884 C A 7: 41,040,809 P43Q probably damaging Het
Gm6588 T A 5: 112,450,071 N161K probably benign Het
Grm8 A G 6: 27,363,780 W579R probably damaging Het
Hsdl2 AG AGCAGCAGCCACAGCTGCCG 4: 59,610,657 probably benign Het
Ivl CTGCTGCTGCTGCTGT C 3: 92,572,343 probably benign Het
Kif18b T C 11: 102,912,366 D506G probably benign Het
Krtap28-10 AGCCAC AGCCACGGCCAC 1: 83,042,135 probably benign Het
Krtap28-10 GCCACAGCCACCACA GCCACAGCCACCACATCCACAGCCACCACA 1: 83,042,274 probably benign Het
Lama1 C A 17: 67,781,062 S1558R Het
Lcmt1 C CCGCGGGGCTT 7: 123,369,836 probably null Het
Lmna A G 3: 88,484,054 V494A probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,388,260 probably null Het
Med12l CAG CAGAAG 3: 59,275,966 probably benign Het
Morc2a T A 11: 3,676,191 M225K probably benign Het
Mpdz G A 4: 81,293,592 A1566V possibly damaging Het
Mpi T C 9: 57,548,641 D186G probably benign Het
Mtmr12 C A 15: 12,261,898 N386K probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myo10 T A 15: 25,799,479 M1376K probably damaging Het
Nbas C T 12: 13,279,408 T118I possibly damaging Het
Nedd4l C T 18: 65,209,680 R755C probably damaging Het
Nefh GACTTGGCCTCACCTGGG GACTTGGCCTCACCTGGGTACTTGGCCTCACCTGGG 11: 4,941,032 probably benign Het
Numa1 T C 7: 101,999,780 L906P probably damaging Het
Olfr750 G A 14: 51,071,012 A127V probably damaging Het
Olfr871 T C 9: 20,212,894 S182P probably benign Het
Otop2 G T 11: 115,323,666 R83L probably benign Het
Pmm1 T A 15: 81,957,813 Q62L probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Ptprj A T 2: 90,471,170 L206* probably null Het
Rassf6 TC TCTGCCTCACTCATGGTCCTGTAGAGCATTGGGGATCC 5: 90,608,941 probably benign Het
Rps19 A AGAAAAT 7: 24,889,180 probably benign Het
Rsrp1 T A 4: 134,923,955 V10E unknown Het
Sh2d6 C T 6: 72,516,388 probably null Het
Six4 TG T 12: 73,103,582 probably null Het
Slc6a15 T A 10: 103,400,216 V264D probably damaging Het
Snapc5 ATGGAAGAAGAGG A 9: 64,182,211 probably benign Het
Sost A T 11: 101,964,132 I117N probably damaging Het
Tbc1d22a AGGTGTGTG A 15: 86,299,774 probably null Het
Tcaf1 C T 6: 42,679,173 V290I probably benign Het
Tcof1 GCA GCACCA 18: 60,835,743 probably benign Het
Tgfbr1 A G 4: 47,353,354 I15V unknown Het
Tmem241 A T 18: 11,983,561 L288Q probably damaging Het
Tnfrsf13b T G 11: 61,141,444 V100G probably benign Het
Trim66 A G 7: 109,460,753 S809P probably damaging Het
Tubb4a C G 17: 57,087,464 G17A possibly damaging Het
Txndc16 A G 14: 45,169,338 V220A probably benign Het
Zan T A 5: 137,391,720 Q4830L unknown Het
Other mutations in Mboat7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02234:Mboat7 APN 7 3691351 missense probably damaging 1.00
IGL02550:Mboat7 APN 7 3683906 splice site probably null
R0013:Mboat7 UTSW 7 3683822 missense probably damaging 1.00
R0013:Mboat7 UTSW 7 3683822 missense probably damaging 1.00
R0046:Mboat7 UTSW 7 3683818 missense probably damaging 1.00
R0046:Mboat7 UTSW 7 3683818 missense probably damaging 1.00
R1649:Mboat7 UTSW 7 3685818 missense probably benign 0.06
R2036:Mboat7 UTSW 7 3685672 critical splice donor site probably null
R2091:Mboat7 UTSW 7 3684011 unclassified probably benign
R3031:Mboat7 UTSW 7 3678688 missense probably benign
R4200:Mboat7 UTSW 7 3685753 missense possibly damaging 0.56
R4382:Mboat7 UTSW 7 3688546 missense possibly damaging 0.53
R5407:Mboat7 UTSW 7 3691381 missense probably damaging 1.00
R6181:Mboat7 UTSW 7 3683885 missense probably benign 0.44
R6785:Mboat7 UTSW 7 3685836 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- CACATGGATACTGAGGACTGGG -3'
(R):5'- GGCTTCCTCTTTAAGAAAGCTGG -3'

Sequencing Primer
(F):5'- TACTGAGGACTGGGGCAAAGAC -3'
(R):5'- CCTCTTTAAGAAAGCTGGTGAGTCAG -3'
Posted On 2019-12-04