Incidental Mutation 'RF013:Gm4884'
ID 603335
Institutional Source Beutler Lab
Gene Symbol Gm4884
Ensembl Gene ENSMUSG00000048312
Gene Name predicted gene 4884
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock # RF013 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 41032719-41045302 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 41040809 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Glutamine at position 43 (P43Q)
Ref Sequence ENSEMBL: ENSMUSP00000133059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164422]
AlphaFold E9PVP9
Predicted Effect probably damaging
Transcript: ENSMUST00000164422
AA Change: P43Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133059
Gene: ENSMUSG00000048312
AA Change: P43Q

Pfam:DUF4629 243 387 8e-62 PFAM
low complexity region 509 533 N/A INTRINSIC
internal_repeat_1 554 584 1.89e-11 PROSPERO
internal_repeat_1 583 613 1.89e-11 PROSPERO
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A G 19: 58,789,294 F28S probably damaging Het
4930435E12Rik T C 16: 38,828,001 T249A probably benign Het
4932438A13Rik TTAT TTATTATTATTATTAGTAT 3: 37,050,757 probably benign Het
Adamts9 A G 6: 92,943,145 V4A possibly damaging Het
AI837181 GGC GGCTGC 19: 5,425,232 probably benign Het
Alk A G 17: 71,895,936 Y1135H probably damaging Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,560,926 probably benign Het
Ano3 A C 2: 110,697,036 L609R probably benign Het
Bicc1 A G 10: 70,935,830 probably null Het
Card6 T C 15: 5,100,142 I591V probably benign Het
Ccdc18 A G 5: 108,220,716 N1235D probably benign Het
Cd109 TTAT TTATTTATTTATCTAT 9: 78,712,531 probably benign Het
Cnpy3 CCT CCTGCT 17: 46,736,744 probably benign Het
Col6a5 GCAGTC GCAGTCTCCAGTC 9: 105,878,597 probably null Het
Cyp8b1 A T 9: 121,915,495 M257K possibly damaging Het
Dbf4 A T 5: 8,397,985 H408Q possibly damaging Het
Defb22 TTGCGGCA TTGCGGCAGAGCTGGCCTGTGCGGCA 2: 152,485,831 probably benign Het
Ercc6l2 A T 13: 63,853,017 T417S probably benign Het
Exd2 AGCCACAG A 12: 80,475,932 probably null Het
Fam171b GC GCAGCATC 2: 83,812,895 probably benign Het
Flvcr2 T A 12: 85,747,186 L112Q probably damaging Het
Flywch1 GTG GTGGGGGGAGGCTACGTACTCACCCACTCCTTTTG 17: 23,762,175 probably null Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 72,270,416 probably benign Het
Gm6588 T A 5: 112,450,071 N161K probably benign Het
Grm8 A G 6: 27,363,780 W579R probably damaging Het
Hsdl2 AG AGCAGCAGCCACAGCTGCCG 4: 59,610,657 probably benign Het
Ivl CTGCTGCTGCTGCTGT C 3: 92,572,343 probably benign Het
Kif18b T C 11: 102,912,366 D506G probably benign Het
Krtap28-10 AGCCAC AGCCACGGCCAC 1: 83,042,135 probably benign Het
Lama1 C A 17: 67,781,062 S1558R Het
Lcmt1 C CCGCGGGGCTT 7: 123,369,836 probably null Het
Lmna A G 3: 88,484,054 V494A probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,388,260 probably null Het
Mboat7 T A 7: 3,691,857 H52L probably damaging Het
Med12l CAG CAGAAG 3: 59,275,966 probably benign Het
Morc2a T A 11: 3,676,191 M225K probably benign Het
Mpdz G A 4: 81,293,592 A1566V possibly damaging Het
Mpi T C 9: 57,548,641 D186G probably benign Het
Mtmr12 C A 15: 12,261,898 N386K probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myo10 T A 15: 25,799,479 M1376K probably damaging Het
Nbas C T 12: 13,279,408 T118I possibly damaging Het
Nedd4l C T 18: 65,209,680 R755C probably damaging Het
Numa1 T C 7: 101,999,780 L906P probably damaging Het
Olfr750 G A 14: 51,071,012 A127V probably damaging Het
Olfr871 T C 9: 20,212,894 S182P probably benign Het
Otop2 G T 11: 115,323,666 R83L probably benign Het
Pmm1 T A 15: 81,957,813 Q62L probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Ptprj A T 2: 90,471,170 L206* probably null Het
Rps19 A AGAAAAT 7: 24,889,180 probably benign Het
Rsrp1 T A 4: 134,923,955 V10E unknown Het
Sh2d6 C T 6: 72,516,388 probably null Het
Six4 TG T 12: 73,103,582 probably null Het
Slc6a15 T A 10: 103,400,216 V264D probably damaging Het
Snapc5 ATGGAAGAAGAGG A 9: 64,182,211 probably benign Het
Sost A T 11: 101,964,132 I117N probably damaging Het
Tbc1d22a AGGTGTGTG A 15: 86,299,774 probably null Het
Tcaf1 C T 6: 42,679,173 V290I probably benign Het
Tcof1 GCA GCACCA 18: 60,835,743 probably benign Het
Tgfbr1 A G 4: 47,353,354 I15V unknown Het
Tmem241 A T 18: 11,983,561 L288Q probably damaging Het
Tnfrsf13b T G 11: 61,141,444 V100G probably benign Het
Trim66 A G 7: 109,460,753 S809P probably damaging Het
Tubb4a C G 17: 57,087,464 G17A possibly damaging Het
Txndc16 A G 14: 45,169,338 V220A probably benign Het
Zan T A 5: 137,391,720 Q4830L unknown Het
Other mutations in Gm4884
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Gm4884 APN 7 41044385 missense probably benign 0.22
IGL00980:Gm4884 APN 7 41043726 missense probably damaging 1.00
IGL02230:Gm4884 APN 7 41043405 missense probably damaging 1.00
IGL03271:Gm4884 APN 7 41043275 missense probably benign 0.33
IGL03274:Gm4884 APN 7 41044545 missense probably damaging 1.00
R0013:Gm4884 UTSW 7 41044292 missense probably damaging 1.00
R0139:Gm4884 UTSW 7 41042963 missense probably benign 0.00
R0179:Gm4884 UTSW 7 41043828 missense probably benign 0.26
R0960:Gm4884 UTSW 7 41042808 missense possibly damaging 0.55
R1167:Gm4884 UTSW 7 41043912 missense possibly damaging 0.92
R1311:Gm4884 UTSW 7 41043115 missense possibly damaging 0.73
R1466:Gm4884 UTSW 7 41043128 missense probably damaging 0.96
R1466:Gm4884 UTSW 7 41043128 missense probably damaging 0.96
R1581:Gm4884 UTSW 7 41043831 missense probably benign 0.09
R1622:Gm4884 UTSW 7 41042841 missense probably damaging 0.99
R1891:Gm4884 UTSW 7 41043115 missense possibly damaging 0.73
R1952:Gm4884 UTSW 7 41044247 missense probably benign 0.02
R2198:Gm4884 UTSW 7 41040805 missense probably benign
R2209:Gm4884 UTSW 7 41043321 missense possibly damaging 0.47
R2210:Gm4884 UTSW 7 41043546 missense possibly damaging 0.72
R2219:Gm4884 UTSW 7 41043486 missense possibly damaging 0.75
R3688:Gm4884 UTSW 7 41043486 missense possibly damaging 0.75
R4437:Gm4884 UTSW 7 41043090 missense probably damaging 0.97
R4472:Gm4884 UTSW 7 41043263 missense probably benign 0.35
R5137:Gm4884 UTSW 7 41042894 missense probably damaging 0.99
R5700:Gm4884 UTSW 7 41043219 missense probably benign 0.22
R5875:Gm4884 UTSW 7 41042936 missense possibly damaging 0.75
R6479:Gm4884 UTSW 7 41040787 missense probably damaging 0.99
R6659:Gm4884 UTSW 7 41044622 missense probably damaging 1.00
R7180:Gm4884 UTSW 7 41044209 missense possibly damaging 0.89
R7844:Gm4884 UTSW 7 41040698 missense probably benign 0.11
R8153:Gm4884 UTSW 7 41043158 missense probably benign 0.17
R8436:Gm4884 UTSW 7 41043386 missense probably damaging 0.97
R8880:Gm4884 UTSW 7 41044487 missense probably damaging 1.00
R8885:Gm4884 UTSW 7 41044684 nonsense probably null
R9406:Gm4884 UTSW 7 41043141 missense probably damaging 1.00
R9621:Gm4884 UTSW 7 41043687 missense possibly damaging 0.76
R9728:Gm4884 UTSW 7 41043265 missense probably benign 0.00
Z1088:Gm4884 UTSW 7 41042876 missense possibly damaging 0.71
Z1177:Gm4884 UTSW 7 41032737 start gained probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04