Incidental Mutation 'RF013:Trim66'
ID 603338
Institutional Source Beutler Lab
Gene Symbol Trim66
Ensembl Gene ENSMUSG00000031026
Gene Name tripartite motif-containing 66
Synonyms Tif1d, D7H11orf29
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock # RF013 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 109449006-109508134 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 109460753 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 809 (S809P)
Ref Sequence ENSEMBL: ENSMUSP00000102352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033339] [ENSMUST00000106739] [ENSMUST00000106741]
AlphaFold Q924W6
Predicted Effect possibly damaging
Transcript: ENSMUST00000033339
AA Change: S707P

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000033339
Gene: ENSMUSG00000031026
AA Change: S707P

PHD 4 69 7.77e0 SMART
BBC 108 234 1.61e-39 SMART
low complexity region 318 333 N/A INTRINSIC
low complexity region 452 486 N/A INTRINSIC
low complexity region 517 530 N/A INTRINSIC
low complexity region 568 581 N/A INTRINSIC
PHD 998 1041 4.09e-10 SMART
BROMO 1069 1175 8.22e-27 SMART
low complexity region 1185 1199 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106739
AA Change: S707P

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102350
Gene: ENSMUSG00000031026
AA Change: S707P

PHD 4 69 7.77e0 SMART
BBC 108 234 1.61e-39 SMART
low complexity region 318 333 N/A INTRINSIC
low complexity region 452 486 N/A INTRINSIC
low complexity region 517 530 N/A INTRINSIC
low complexity region 568 581 N/A INTRINSIC
PHD 998 1041 4.09e-10 SMART
BROMO 1069 1175 8.22e-27 SMART
low complexity region 1185 1199 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106741
AA Change: S809P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102352
Gene: ENSMUSG00000031026
AA Change: S809P

RING 28 78 2.38e-2 SMART
BBOX 102 140 1.48e0 SMART
PHD 106 171 7.77e0 SMART
RING 107 170 4.38e0 SMART
BBOX 162 203 4.21e-3 SMART
BBC 210 336 1.61e-39 SMART
low complexity region 420 435 N/A INTRINSIC
low complexity region 554 588 N/A INTRINSIC
low complexity region 619 632 N/A INTRINSIC
low complexity region 670 683 N/A INTRINSIC
PHD 1100 1143 4.09e-10 SMART
BROMO 1171 1277 8.22e-27 SMART
low complexity region 1287 1301 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A G 19: 58,789,294 F28S probably damaging Het
4930435E12Rik T C 16: 38,828,001 T249A probably benign Het
4932438A13Rik TTAT TTATTATTATTATTAGTAT 3: 37,050,757 probably benign Het
Adamts9 A G 6: 92,943,145 V4A possibly damaging Het
AI837181 GGC GGCTGC 19: 5,425,232 probably benign Het
Alk A G 17: 71,895,936 Y1135H probably damaging Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,560,926 probably benign Het
Ano3 A C 2: 110,697,036 L609R probably benign Het
Bicc1 A G 10: 70,935,830 probably null Het
Card6 T C 15: 5,100,142 I591V probably benign Het
Ccdc18 A G 5: 108,220,716 N1235D probably benign Het
Cd109 TTAT TTATTTATTTATCTAT 9: 78,712,531 probably benign Het
Cnpy3 CCT CCTGCT 17: 46,736,744 probably benign Het
Col6a5 GCAGTC GCAGTCTCCAGTC 9: 105,878,597 probably null Het
Cyp8b1 A T 9: 121,915,495 M257K possibly damaging Het
Dbf4 A T 5: 8,397,985 H408Q possibly damaging Het
Defb22 TTGCGGCA TTGCGGCAGAGCTGGCCTGTGCGGCA 2: 152,485,831 probably benign Het
Ercc6l2 A T 13: 63,853,017 T417S probably benign Het
Exd2 AGCCACAG A 12: 80,475,932 probably null Het
Fam171b GC GCAGCATC 2: 83,812,895 probably benign Het
Flvcr2 T A 12: 85,747,186 L112Q probably damaging Het
Flywch1 GTG GTGGGGGGAGGCTACGTACTCACCCACTCCTTTTG 17: 23,762,175 probably null Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 72,270,416 probably benign Het
Gm4884 C A 7: 41,040,809 P43Q probably damaging Het
Gm6588 T A 5: 112,450,071 N161K probably benign Het
Grm8 A G 6: 27,363,780 W579R probably damaging Het
Hsdl2 AG AGCAGCAGCCACAGCTGCCG 4: 59,610,657 probably benign Het
Ivl CTGCTGCTGCTGCTGT C 3: 92,572,343 probably benign Het
Kif18b T C 11: 102,912,366 D506G probably benign Het
Krtap28-10 AGCCAC AGCCACGGCCAC 1: 83,042,135 probably benign Het
Lama1 C A 17: 67,781,062 S1558R Het
Lcmt1 C CCGCGGGGCTT 7: 123,369,836 probably null Het
Lmna A G 3: 88,484,054 V494A probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,388,260 probably null Het
Mboat7 T A 7: 3,691,857 H52L probably damaging Het
Med12l CAG CAGAAG 3: 59,275,966 probably benign Het
Morc2a T A 11: 3,676,191 M225K probably benign Het
Mpdz G A 4: 81,293,592 A1566V possibly damaging Het
Mpi T C 9: 57,548,641 D186G probably benign Het
Mtmr12 C A 15: 12,261,898 N386K probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myo10 T A 15: 25,799,479 M1376K probably damaging Het
Nbas C T 12: 13,279,408 T118I possibly damaging Het
Nedd4l C T 18: 65,209,680 R755C probably damaging Het
Numa1 T C 7: 101,999,780 L906P probably damaging Het
Olfr750 G A 14: 51,071,012 A127V probably damaging Het
Olfr871 T C 9: 20,212,894 S182P probably benign Het
Otop2 G T 11: 115,323,666 R83L probably benign Het
Pmm1 T A 15: 81,957,813 Q62L probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Ptprj A T 2: 90,471,170 L206* probably null Het
Rps19 A AGAAAAT 7: 24,889,180 probably benign Het
Rsrp1 T A 4: 134,923,955 V10E unknown Het
Sh2d6 C T 6: 72,516,388 probably null Het
Six4 TG T 12: 73,103,582 probably null Het
Slc6a15 T A 10: 103,400,216 V264D probably damaging Het
Snapc5 ATGGAAGAAGAGG A 9: 64,182,211 probably benign Het
Sost A T 11: 101,964,132 I117N probably damaging Het
Tbc1d22a AGGTGTGTG A 15: 86,299,774 probably null Het
Tcaf1 C T 6: 42,679,173 V290I probably benign Het
Tcof1 GCA GCACCA 18: 60,835,743 probably benign Het
Tgfbr1 A G 4: 47,353,354 I15V unknown Het
Tmem241 A T 18: 11,983,561 L288Q probably damaging Het
Tnfrsf13b T G 11: 61,141,444 V100G probably benign Het
Tubb4a C G 17: 57,087,464 G17A possibly damaging Het
Txndc16 A G 14: 45,169,338 V220A probably benign Het
Zan T A 5: 137,391,720 Q4830L unknown Het
Other mutations in Trim66
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01539:Trim66 APN 7 109455066 missense probably benign 0.02
IGL01758:Trim66 APN 7 109486045 critical splice donor site probably null
IGL01982:Trim66 APN 7 109458763 missense probably benign 0.00
IGL01983:Trim66 APN 7 109458251 nonsense probably null
IGL02149:Trim66 APN 7 109460902 missense possibly damaging 0.66
IGL02392:Trim66 APN 7 109460274 missense probably benign 0.01
IGL02483:Trim66 APN 7 109477630 splice site probably benign
IGL02832:Trim66 APN 7 109460497 missense probably damaging 1.00
IGL02945:Trim66 APN 7 109460176 nonsense probably null
IGL03085:Trim66 APN 7 109458745 missense probably benign 0.17
PIT1430001:Trim66 UTSW 7 109475247 missense probably damaging 0.99
R0326:Trim66 UTSW 7 109460172 missense probably benign 0.00
R0358:Trim66 UTSW 7 109460176 nonsense probably null
R0401:Trim66 UTSW 7 109475264 missense probably damaging 0.98
R0470:Trim66 UTSW 7 109457542 splice site probably benign
R0568:Trim66 UTSW 7 109460695 missense probably benign 0.00
R0669:Trim66 UTSW 7 109454992 intron probably benign
R0980:Trim66 UTSW 7 109455670 missense probably damaging 1.00
R1015:Trim66 UTSW 7 109455233 missense probably damaging 1.00
R1078:Trim66 UTSW 7 109472319 missense probably damaging 1.00
R1099:Trim66 UTSW 7 109475454 missense probably benign 0.34
R1181:Trim66 UTSW 7 109484577 critical splice donor site probably null
R1497:Trim66 UTSW 7 109484619 missense probably benign 0.00
R1583:Trim66 UTSW 7 109455080 missense probably damaging 1.00
R1843:Trim66 UTSW 7 109475839 missense probably damaging 0.99
R1998:Trim66 UTSW 7 109484577 critical splice donor site probably null
R2016:Trim66 UTSW 7 109472232 critical splice donor site probably null
R2143:Trim66 UTSW 7 109475113 missense probably damaging 0.98
R2144:Trim66 UTSW 7 109475113 missense probably damaging 0.98
R2145:Trim66 UTSW 7 109475113 missense probably damaging 0.98
R3945:Trim66 UTSW 7 109472268 missense possibly damaging 0.94
R4012:Trim66 UTSW 7 109458131 missense probably damaging 0.98
R4464:Trim66 UTSW 7 109477690 missense possibly damaging 0.51
R4473:Trim66 UTSW 7 109481995 missense probably damaging 1.00
R4729:Trim66 UTSW 7 109456060 critical splice donor site probably null
R4730:Trim66 UTSW 7 109483069 missense probably damaging 1.00
R4775:Trim66 UTSW 7 109457589 nonsense probably null
R4819:Trim66 UTSW 7 109457586 missense probably damaging 1.00
R5269:Trim66 UTSW 7 109457590 missense probably benign 0.00
R5557:Trim66 UTSW 7 109483737 missense probably benign 0.06
R5832:Trim66 UTSW 7 109455202 missense probably damaging 1.00
R6220:Trim66 UTSW 7 109483093 missense probably damaging 0.97
R6243:Trim66 UTSW 7 109460274 missense probably benign 0.01
R6374:Trim66 UTSW 7 109486062 missense probably benign
R6450:Trim66 UTSW 7 109460738 missense probably benign 0.09
R6543:Trim66 UTSW 7 109475879 missense probably benign 0.01
R6788:Trim66 UTSW 7 109477754 missense probably damaging 1.00
R6842:Trim66 UTSW 7 109460776 missense probably benign 0.00
R7169:Trim66 UTSW 7 109455121 missense probably benign 0.25
R7257:Trim66 UTSW 7 109460244 missense probably damaging 1.00
R7328:Trim66 UTSW 7 109457751 missense probably damaging 0.99
R7616:Trim66 UTSW 7 109483749 missense probably damaging 0.99
R8423:Trim66 UTSW 7 109475392 missense possibly damaging 0.77
R8855:Trim66 UTSW 7 109481981 missense probably damaging 1.00
R9130:Trim66 UTSW 7 109477689 missense possibly damaging 0.90
R9137:Trim66 UTSW 7 109475123 missense probably damaging 0.99
R9640:Trim66 UTSW 7 109475618 missense probably damaging 1.00
RF024:Trim66 UTSW 7 109460740 missense possibly damaging 0.62
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04