Incidental Mutation 'RF013:Lcmt1'
ID 603339
Institutional Source Beutler Lab
Gene Symbol Lcmt1
Ensembl Gene ENSMUSG00000030763
Gene Name leucine carboxyl methyltransferase 1
Synonyms LCMT-1, Lcmt
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # RF013 (G1)
Quality Score 210.475
Status Not validated
Chromosome 7
Chromosomal Location 123369784-123430358 bp(+) (GRCm38)
Type of Mutation frame shift
DNA Base Change (assembly) C to CCGCGGGGCTT at 123369836 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098060] [ENSMUST00000106442] [ENSMUST00000167309] [ENSMUST00000205262] [ENSMUST00000205936] [ENSMUST00000206117] [ENSMUST00000206721] [ENSMUST00000207010]
AlphaFold A0A0U1RNF2
Predicted Effect probably benign
Transcript: ENSMUST00000098060
SMART Domains Protein: ENSMUSP00000095668
Gene: ENSMUSG00000030766

BAR 1 239 4.45e-65 SMART
RhoGAP 263 439 1.2e-60 SMART
low complexity region 554 595 N/A INTRINSIC
low complexity region 624 640 N/A INTRINSIC
low complexity region 644 664 N/A INTRINSIC
low complexity region 683 704 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106442
SMART Domains Protein: ENSMUSP00000102050
Gene: ENSMUSG00000030766

BAR 1 239 4.45e-65 SMART
RhoGAP 263 439 1.2e-60 SMART
low complexity region 542 557 N/A INTRINSIC
low complexity region 570 582 N/A INTRINSIC
low complexity region 632 673 N/A INTRINSIC
low complexity region 702 718 N/A INTRINSIC
low complexity region 722 742 N/A INTRINSIC
low complexity region 761 782 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167309
SMART Domains Protein: ENSMUSP00000128447
Gene: ENSMUSG00000030766

BAR 1 239 4.45e-65 SMART
RhoGAP 263 439 1.2e-60 SMART
low complexity region 542 557 N/A INTRINSIC
low complexity region 570 582 N/A INTRINSIC
low complexity region 632 673 N/A INTRINSIC
low complexity region 702 718 N/A INTRINSIC
low complexity region 722 742 N/A INTRINSIC
low complexity region 761 782 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205262
Predicted Effect probably benign
Transcript: ENSMUST00000205936
Predicted Effect probably benign
Transcript: ENSMUST00000206117
Predicted Effect probably null
Transcript: ENSMUST00000206721
Predicted Effect probably benign
Transcript: ENSMUST00000207010
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LCMT1 catalyzes the methylation of the carboxyl group of the C-terminal leucine residue (leu309) of the catalytic subunit of protein phosphatase-2A (PPP2CA; MIM 176915) (De Baere et al., 1999 [PubMed 10600115]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele are embryonic lethal. Mice homozygous for a hypomorphic gene trap allele exhibit partial embryonic lethality, insulin resistance and impaired glucose tolerance. Mice homozygous for a transgenic gene disruption exhibit kidney agenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A G 19: 58,789,294 F28S probably damaging Het
4930435E12Rik T C 16: 38,828,001 T249A probably benign Het
4932438A13Rik TTAT TTATTATTATTATTAGTAT 3: 37,050,757 probably benign Het
Adamts9 A G 6: 92,943,145 V4A possibly damaging Het
AI837181 GGC GGCTGC 19: 5,425,232 probably benign Het
Alk A G 17: 71,895,936 Y1135H probably damaging Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,560,926 probably benign Het
Ano3 A C 2: 110,697,036 L609R probably benign Het
Bicc1 A G 10: 70,935,830 probably null Het
Card6 T C 15: 5,100,142 I591V probably benign Het
Ccdc18 A G 5: 108,220,716 N1235D probably benign Het
Cd109 TTAT TTATTTATTTATCTAT 9: 78,712,531 probably benign Het
Cnpy3 CCT CCTGCT 17: 46,736,744 probably benign Het
Col6a5 GCAGTC GCAGTCTCCAGTC 9: 105,878,597 probably null Het
Cyp8b1 A T 9: 121,915,495 M257K possibly damaging Het
Dbf4 A T 5: 8,397,985 H408Q possibly damaging Het
Defb22 TTGCGGCA TTGCGGCAGAGCTGGCCTGTGCGGCA 2: 152,485,831 probably benign Het
Ercc6l2 A T 13: 63,853,017 T417S probably benign Het
Exd2 AGCCACAG A 12: 80,475,932 probably null Het
Fam171b GC GCAGCATC 2: 83,812,895 probably benign Het
Flvcr2 T A 12: 85,747,186 L112Q probably damaging Het
Flywch1 GTG GTGGGGGGAGGCTACGTACTCACCCACTCCTTTTG 17: 23,762,175 probably null Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 72,270,416 probably benign Het
Gm4884 C A 7: 41,040,809 P43Q probably damaging Het
Gm6588 T A 5: 112,450,071 N161K probably benign Het
Grm8 A G 6: 27,363,780 W579R probably damaging Het
Hsdl2 AG AGCAGCAGCCACAGCTGCCG 4: 59,610,657 probably benign Het
Ivl CTGCTGCTGCTGCTGT C 3: 92,572,343 probably benign Het
Kif18b T C 11: 102,912,366 D506G probably benign Het
Krtap28-10 AGCCAC AGCCACGGCCAC 1: 83,042,135 probably benign Het
Lama1 C A 17: 67,781,062 S1558R Het
Lmna A G 3: 88,484,054 V494A probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,388,260 probably null Het
Mboat7 T A 7: 3,691,857 H52L probably damaging Het
Med12l CAG CAGAAG 3: 59,275,966 probably benign Het
Morc2a T A 11: 3,676,191 M225K probably benign Het
Mpdz G A 4: 81,293,592 A1566V possibly damaging Het
Mpi T C 9: 57,548,641 D186G probably benign Het
Mtmr12 C A 15: 12,261,898 N386K probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myo10 T A 15: 25,799,479 M1376K probably damaging Het
Nbas C T 12: 13,279,408 T118I possibly damaging Het
Nedd4l C T 18: 65,209,680 R755C probably damaging Het
Numa1 T C 7: 101,999,780 L906P probably damaging Het
Olfr750 G A 14: 51,071,012 A127V probably damaging Het
Olfr871 T C 9: 20,212,894 S182P probably benign Het
Otop2 G T 11: 115,323,666 R83L probably benign Het
Pmm1 T A 15: 81,957,813 Q62L probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Ptprj A T 2: 90,471,170 L206* probably null Het
Rps19 A AGAAAAT 7: 24,889,180 probably benign Het
Rsrp1 T A 4: 134,923,955 V10E unknown Het
Sh2d6 C T 6: 72,516,388 probably null Het
Six4 TG T 12: 73,103,582 probably null Het
Slc6a15 T A 10: 103,400,216 V264D probably damaging Het
Snapc5 ATGGAAGAAGAGG A 9: 64,182,211 probably benign Het
Sost A T 11: 101,964,132 I117N probably damaging Het
Tbc1d22a AGGTGTGTG A 15: 86,299,774 probably null Het
Tcaf1 C T 6: 42,679,173 V290I probably benign Het
Tcof1 GCA GCACCA 18: 60,835,743 probably benign Het
Tgfbr1 A G 4: 47,353,354 I15V unknown Het
Tmem241 A T 18: 11,983,561 L288Q probably damaging Het
Tnfrsf13b T G 11: 61,141,444 V100G probably benign Het
Trim66 A G 7: 109,460,753 S809P probably damaging Het
Tubb4a C G 17: 57,087,464 G17A possibly damaging Het
Txndc16 A G 14: 45,169,338 V220A probably benign Het
Zan T A 5: 137,391,720 Q4830L unknown Het
Other mutations in Lcmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Lcmt1 APN 7 123428153 missense probably damaging 1.00
IGL01536:Lcmt1 APN 7 123422743 missense possibly damaging 0.46
IGL01564:Lcmt1 APN 7 123404440 missense probably benign 0.00
IGL02598:Lcmt1 APN 7 123421648 splice site probably benign
rancho UTSW 7 123401495 missense probably benign 0.03
relasso UTSW 7 123401468 missense probably damaging 1.00
R0665:Lcmt1 UTSW 7 123402871 missense probably damaging 1.00
R0668:Lcmt1 UTSW 7 123402871 missense probably damaging 1.00
R0943:Lcmt1 UTSW 7 123401439 splice site probably null
R1574:Lcmt1 UTSW 7 123402908 missense probably damaging 1.00
R1574:Lcmt1 UTSW 7 123402908 missense probably damaging 1.00
R2896:Lcmt1 UTSW 7 123421586 missense possibly damaging 0.95
R3017:Lcmt1 UTSW 7 123430136 missense probably damaging 1.00
R3547:Lcmt1 UTSW 7 123400479 missense probably benign 0.07
R3714:Lcmt1 UTSW 7 123404460 missense probably damaging 0.98
R4092:Lcmt1 UTSW 7 123418253 missense probably damaging 1.00
R4628:Lcmt1 UTSW 7 123410812 nonsense probably null
R5062:Lcmt1 UTSW 7 123410830 splice site probably null
R5096:Lcmt1 UTSW 7 123401468 missense probably damaging 1.00
R5549:Lcmt1 UTSW 7 123428107 missense probably damaging 1.00
R5573:Lcmt1 UTSW 7 123401463 missense probably benign 0.03
R5931:Lcmt1 UTSW 7 123421616 missense probably benign
R6331:Lcmt1 UTSW 7 123378182 intron probably benign
R7752:Lcmt1 UTSW 7 123369807 missense unknown
R7784:Lcmt1 UTSW 7 123401495 missense probably benign 0.03
R8447:Lcmt1 UTSW 7 123421602 missense probably damaging 1.00
R8499:Lcmt1 UTSW 7 123430148 missense probably benign 0.02
R8743:Lcmt1 UTSW 7 123400468 missense probably damaging 1.00
R8962:Lcmt1 UTSW 7 123401446 missense probably damaging 1.00
R9760:Lcmt1 UTSW 7 123430152 nonsense probably null
RF025:Lcmt1 UTSW 7 123369834 frame shift probably null
RF046:Lcmt1 UTSW 7 123369834 frame shift probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04