Incidental Mutation 'RF013:Olfr871'
ID 603340
Institutional Source Beutler Lab
Gene Symbol Olfr871
Ensembl Gene ENSMUSG00000061457
Gene Name olfactory receptor 871
Synonyms GA_x6K02T2PVTD-13952555-13953490, MOR141-2
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # RF013 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 20212207-20213353 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 20212894 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 182 (S182P)
Ref Sequence ENSEMBL: ENSMUSP00000072865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073122]
AlphaFold Q7TRF0
Predicted Effect probably benign
Transcript: ENSMUST00000073122
AA Change: S182P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000072865
Gene: ENSMUSG00000061457
AA Change: S182P

Pfam:7tm_4 31 311 8.3e-52 PFAM
Pfam:7TM_GPCR_Srsx 35 304 2.1e-7 PFAM
Pfam:7tm_1 41 290 9.1e-28 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A G 19: 58,789,294 F28S probably damaging Het
4930435E12Rik T C 16: 38,828,001 T249A probably benign Het
4932438A13Rik TTAT TTATTATTATTATTAGTAT 3: 37,050,757 probably benign Het
Adamts9 A G 6: 92,943,145 V4A possibly damaging Het
AI837181 GGC GGCTGC 19: 5,425,232 probably benign Het
Alk A G 17: 71,895,936 Y1135H probably damaging Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,560,926 probably benign Het
Ano3 A C 2: 110,697,036 L609R probably benign Het
Bicc1 A G 10: 70,935,830 probably null Het
Card6 T C 15: 5,100,142 I591V probably benign Het
Ccdc18 A G 5: 108,220,716 N1235D probably benign Het
Cd109 TTAT TTATTTATTTATCTAT 9: 78,712,531 probably benign Het
Cnpy3 CCT CCTGCT 17: 46,736,744 probably benign Het
Col6a5 GCAGTC GCAGTCTCCAGTC 9: 105,878,597 probably null Het
Cyp8b1 A T 9: 121,915,495 M257K possibly damaging Het
Dbf4 A T 5: 8,397,985 H408Q possibly damaging Het
Defb22 TTGCGGCA TTGCGGCAGAGCTGGCCTGTGCGGCA 2: 152,485,831 probably benign Het
Ercc6l2 A T 13: 63,853,017 T417S probably benign Het
Exd2 AGCCACAG A 12: 80,475,932 probably null Het
Fam171b GC GCAGCATC 2: 83,812,895 probably benign Het
Flvcr2 T A 12: 85,747,186 L112Q probably damaging Het
Flywch1 GTG GTGGGGGGAGGCTACGTACTCACCCACTCCTTTTG 17: 23,762,175 probably null Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 72,270,416 probably benign Het
Gm4884 C A 7: 41,040,809 P43Q probably damaging Het
Gm6588 T A 5: 112,450,071 N161K probably benign Het
Grm8 A G 6: 27,363,780 W579R probably damaging Het
Hsdl2 AG AGCAGCAGCCACAGCTGCCG 4: 59,610,657 probably benign Het
Ivl CTGCTGCTGCTGCTGT C 3: 92,572,343 probably benign Het
Kif18b T C 11: 102,912,366 D506G probably benign Het
Krtap28-10 AGCCAC AGCCACGGCCAC 1: 83,042,135 probably benign Het
Lama1 C A 17: 67,781,062 S1558R Het
Lcmt1 C CCGCGGGGCTT 7: 123,369,836 probably null Het
Lmna A G 3: 88,484,054 V494A probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,388,260 probably null Het
Mboat7 T A 7: 3,691,857 H52L probably damaging Het
Med12l CAG CAGAAG 3: 59,275,966 probably benign Het
Morc2a T A 11: 3,676,191 M225K probably benign Het
Mpdz G A 4: 81,293,592 A1566V possibly damaging Het
Mpi T C 9: 57,548,641 D186G probably benign Het
Mtmr12 C A 15: 12,261,898 N386K probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myo10 T A 15: 25,799,479 M1376K probably damaging Het
Nbas C T 12: 13,279,408 T118I possibly damaging Het
Nedd4l C T 18: 65,209,680 R755C probably damaging Het
Numa1 T C 7: 101,999,780 L906P probably damaging Het
Olfr750 G A 14: 51,071,012 A127V probably damaging Het
Otop2 G T 11: 115,323,666 R83L probably benign Het
Pmm1 T A 15: 81,957,813 Q62L probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Ptprj A T 2: 90,471,170 L206* probably null Het
Rps19 A AGAAAAT 7: 24,889,180 probably benign Het
Rsrp1 T A 4: 134,923,955 V10E unknown Het
Sh2d6 C T 6: 72,516,388 probably null Het
Six4 TG T 12: 73,103,582 probably null Het
Slc6a15 T A 10: 103,400,216 V264D probably damaging Het
Snapc5 ATGGAAGAAGAGG A 9: 64,182,211 probably benign Het
Sost A T 11: 101,964,132 I117N probably damaging Het
Tbc1d22a AGGTGTGTG A 15: 86,299,774 probably null Het
Tcaf1 C T 6: 42,679,173 V290I probably benign Het
Tcof1 GCA GCACCA 18: 60,835,743 probably benign Het
Tgfbr1 A G 4: 47,353,354 I15V unknown Het
Tmem241 A T 18: 11,983,561 L288Q probably damaging Het
Tnfrsf13b T G 11: 61,141,444 V100G probably benign Het
Trim66 A G 7: 109,460,753 S809P probably damaging Het
Tubb4a C G 17: 57,087,464 G17A possibly damaging Het
Txndc16 A G 14: 45,169,338 V220A probably benign Het
Zan T A 5: 137,391,720 Q4830L unknown Het
Other mutations in Olfr871
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01977:Olfr871 APN 9 20212459 missense possibly damaging 0.89
IGL02291:Olfr871 APN 9 20212802 missense probably benign 0.00
IGL02312:Olfr871 APN 9 20213081 missense probably damaging 1.00
IGL02345:Olfr871 APN 9 20213018 missense possibly damaging 0.88
R0278:Olfr871 UTSW 9 20212886 missense probably damaging 1.00
R0520:Olfr871 UTSW 9 20212495 missense probably benign 0.01
R1606:Olfr871 UTSW 9 20212946 missense probably benign 0.05
R3751:Olfr871 UTSW 9 20213260 missense probably damaging 0.98
R4701:Olfr871 UTSW 9 20212625 missense probably damaging 1.00
R4811:Olfr871 UTSW 9 20212753 missense probably damaging 1.00
R5074:Olfr871 UTSW 9 20212582 missense possibly damaging 0.63
R5406:Olfr871 UTSW 9 20213158 missense probably benign 0.08
R6541:Olfr871 UTSW 9 20212399 missense probably benign 0.01
R6730:Olfr871 UTSW 9 20212502 missense probably benign 0.04
R7195:Olfr871 UTSW 9 20212544 missense probably damaging 0.99
R7197:Olfr871 UTSW 9 20212555 missense probably benign 0.00
R7384:Olfr871 UTSW 9 20212745 missense probably damaging 1.00
R7715:Olfr871 UTSW 9 20212435 missense probably damaging 0.97
R7715:Olfr871 UTSW 9 20212436 missense probably benign 0.06
R8108:Olfr871 UTSW 9 20212451 missense possibly damaging 0.62
R8409:Olfr871 UTSW 9 20212246 start gained probably benign
R8861:Olfr871 UTSW 9 20213081 missense probably damaging 1.00
R9147:Olfr871 UTSW 9 20213062 missense probably damaging 1.00
R9148:Olfr871 UTSW 9 20213062 missense probably damaging 1.00
R9154:Olfr871 UTSW 9 20212877 missense possibly damaging 0.87
R9665:Olfr871 UTSW 9 20213106 nonsense probably null
R9743:Olfr871 UTSW 9 20212544 missense probably damaging 0.99
Z1176:Olfr871 UTSW 9 20212844 missense possibly damaging 0.94
Z1177:Olfr871 UTSW 9 20213186 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04