Incidental Mutation 'RF013:Snapc5'
ID 603342
Institutional Source Beutler Lab
Gene Symbol Snapc5
Ensembl Gene ENSMUSG00000032398
Gene Name small nuclear RNA activating complex, polypeptide 5
Synonyms 2010103A03Rik
Accession Numbers
Essential gene? Probably essential (E-score: 0.948) question?
Stock # RF013 (G1)
Quality Score 217.468
Status Not validated
Chromosome 9
Chromosomal Location 64086556-64090414 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) ATGGAAGAAGAGG to A at 64089493 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005066] [ENSMUST00000034965] [ENSMUST00000034966]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000005066
SMART Domains Protein: ENSMUSP00000005066
Gene: ENSMUSG00000004936

DomainStartEndE-ValueType
low complexity region 30 51 N/A INTRINSIC
S_TKc 68 361 4.44e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000034965
SMART Domains Protein: ENSMUSP00000034965
Gene: ENSMUSG00000032398

DomainStartEndE-ValueType
Pfam:SNAPc19 7 101 5.4e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000034966
SMART Domains Protein: ENSMUSP00000034966
Gene: ENSMUSG00000032399

DomainStartEndE-ValueType
Pfam:Ribosomal_L4 22 263 9.7e-47 PFAM
Pfam:Ribos_L4_asso_C 275 349 4e-34 PFAM
low complexity region 352 367 N/A INTRINSIC
low complexity region 375 419 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the small nuclear RNA (snRNA)-activating protein complex that plays a role in the transcription of snRNA genes. This complex binds to the promoters of snRNA genes transcribed by either RNA polymerase II or III and recruits other regulatory factors to activate snRNA gene transcription. The encoded protein may play a role in stabilizing this complex. A pseudogene of this gene has been identified on chromosome 6. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,989,553 (GRCm39) probably benign Het
Adamts9 A G 6: 92,920,126 (GRCm39) V4A possibly damaging Het
AI837181 GGC GGCTGC 19: 5,475,260 (GRCm39) probably benign Het
Alk A G 17: 72,202,931 (GRCm39) Y1135H probably damaging Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,693,979 (GRCm39) probably benign Het
Ano3 A C 2: 110,527,381 (GRCm39) L609R probably benign Het
Bicc1 A G 10: 70,771,660 (GRCm39) probably null Het
Bltp1 TTAT TTATTATTATTATTAGTAT 3: 37,104,906 (GRCm39) probably benign Het
Card6 T C 15: 5,129,624 (GRCm39) I591V probably benign Het
Ccdc121rt2 T A 5: 112,597,937 (GRCm39) N161K probably benign Het
Ccdc18 A G 5: 108,368,582 (GRCm39) N1235D probably benign Het
Cd109 TTAT TTATTTATTTATCTAT 9: 78,619,813 (GRCm39) probably benign Het
Cnpy3 CCT CCTGCT 17: 47,047,670 (GRCm39) probably benign Het
Col6a5 GCAGTC GCAGTCTCCAGTC 9: 105,755,796 (GRCm39) probably null Het
Cyb5r4 GACACACTGCCCAGGGA GACACACTGCCCAGGGATGTGACACACACACTGCCCAGGGA 9: 86,922,485 (GRCm39) probably benign Het
Cyp8b1 A T 9: 121,744,561 (GRCm39) M257K possibly damaging Het
Dbf4 A T 5: 8,447,985 (GRCm39) H408Q possibly damaging Het
Defb22 TTGCGGCA TTGCGGCAGAGCTGGCCTGTGCGGCA 2: 152,327,751 (GRCm39) probably benign Het
Ercc6l2 A T 13: 64,000,831 (GRCm39) T417S probably benign Het
Exd2 AGCCACAG A 12: 80,522,706 (GRCm39) probably null Het
Fam171b GC GCAGCATC 2: 83,643,239 (GRCm39) probably benign Het
Flvcr2 T A 12: 85,793,960 (GRCm39) L112Q probably damaging Het
Flywch1 GTG GTGGGGGGAGGCTACGTACTCACCCACTCCTTTTG 17: 23,981,149 (GRCm39) probably null Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 71,314,022 (GRCm39) probably benign Het
Garin5a CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGACGGCTGGATCCTGGATCACTGGGTCTGAGGGAGGA 7: 44,149,944 (GRCm39) probably null Het
Gm4884 C A 7: 40,690,233 (GRCm39) P43Q probably damaging Het
Grm8 A G 6: 27,363,779 (GRCm39) W579R probably damaging Het
Hsdl2 AG AGCAGCAGCCACAGCTGCCG 4: 59,610,657 (GRCm39) probably benign Het
Ivl CTGCTGCTGCTGCTGT C 3: 92,479,650 (GRCm39) probably benign Het
Kif18b T C 11: 102,803,192 (GRCm39) D506G probably benign Het
Krtap28-10 AGCCAC AGCCACGGCCAC 1: 83,019,856 (GRCm39) probably benign Het
Krtap28-10 GCCACAGCCACCACA GCCACAGCCACCACATCCACAGCCACCACA 1: 83,019,995 (GRCm39) probably benign Het
Lama1 C A 17: 68,088,057 (GRCm39) S1558R Het
Lcmt1 C CCGCGGGGCTT 7: 122,969,059 (GRCm39) probably null Het
Lmna A G 3: 88,391,361 (GRCm39) V494A probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,295,542 (GRCm39) probably null Het
Mboat7 T A 7: 3,694,856 (GRCm39) H52L probably damaging Het
Med12l CAG CAGAAG 3: 59,183,387 (GRCm39) probably benign Het
Morc2a T A 11: 3,626,191 (GRCm39) M225K probably benign Het
Mpdz G A 4: 81,211,829 (GRCm39) A1566V possibly damaging Het
Mpi T C 9: 57,455,924 (GRCm39) D186G probably benign Het
Mtmr12 C A 15: 12,261,984 (GRCm39) N386K probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 66,977,182 (GRCm39) probably null Het
Myo10 T A 15: 25,799,565 (GRCm39) M1376K probably damaging Het
Nbas C T 12: 13,329,409 (GRCm39) T118I possibly damaging Het
Nedd4l C T 18: 65,342,751 (GRCm39) R755C probably damaging Het
Nefh GACTTGGCCTCACCTGGG GACTTGGCCTCACCTGGGTACTTGGCCTCACCTGGG 11: 4,891,032 (GRCm39) probably benign Het
Numa1 T C 7: 101,648,987 (GRCm39) L906P probably damaging Het
Or6s1 G A 14: 51,308,469 (GRCm39) A127V probably damaging Het
Or7h8 T C 9: 20,124,190 (GRCm39) S182P probably benign Het
Otop2 G T 11: 115,214,492 (GRCm39) R83L probably benign Het
Pmm1 T A 15: 81,842,014 (GRCm39) Q62L probably damaging Het
Pramel16 C G 4: 143,675,478 (GRCm39) Q449H probably damaging Het
Ptprj A T 2: 90,301,514 (GRCm39) L206* probably null Het
Rassf6 TC TCTGCCTCACTCATGGTCCTGTAGAGCATTGGGGATCC 5: 90,756,800 (GRCm39) probably benign Het
Rps19 A AGAAAAT 7: 24,588,605 (GRCm39) probably benign Het
Rsrp1 T A 4: 134,651,266 (GRCm39) V10E unknown Het
Sh2d6 C T 6: 72,493,371 (GRCm39) probably null Het
Six4 TG T 12: 73,150,356 (GRCm39) probably null Het
Slc6a15 T A 10: 103,236,077 (GRCm39) V264D probably damaging Het
Sost A T 11: 101,854,958 (GRCm39) I117N probably damaging Het
Spmip5 A G 19: 58,777,726 (GRCm39) F28S probably damaging Het
Tbc1d22a AGGTGTGTG A 15: 86,183,975 (GRCm39) probably null Het
Tcaf1 C T 6: 42,656,107 (GRCm39) V290I probably benign Het
Tcof1 GCA GCACCA 18: 60,968,815 (GRCm39) probably benign Het
Tex55 T C 16: 38,648,363 (GRCm39) T249A probably benign Het
Tgfbr1 A G 4: 47,353,354 (GRCm39) I15V unknown Het
Tmem241 A T 18: 12,116,618 (GRCm39) L288Q probably damaging Het
Tnfrsf13b T G 11: 61,032,270 (GRCm39) V100G probably benign Het
Trim66 A G 7: 109,059,960 (GRCm39) S809P probably damaging Het
Tubb4a C G 17: 57,394,464 (GRCm39) G17A possibly damaging Het
Txndc16 A G 14: 45,406,795 (GRCm39) V220A probably benign Het
Zan T A 5: 137,389,982 (GRCm39) Q4830L unknown Het
Other mutations in Snapc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01759:Snapc5 APN 9 64,087,779 (GRCm39) critical splice acceptor site probably null
R0400:Snapc5 UTSW 9 64,087,789 (GRCm39) missense probably damaging 1.00
R0606:Snapc5 UTSW 9 64,086,582 (GRCm39) unclassified probably benign
R4097:Snapc5 UTSW 9 64,087,809 (GRCm39) missense probably damaging 0.99
R6322:Snapc5 UTSW 9 64,089,455 (GRCm39) missense probably damaging 1.00
R7895:Snapc5 UTSW 9 64,086,614 (GRCm39) start codon destroyed probably null
RF011:Snapc5 UTSW 9 64,089,493 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGGCAACAAGTACTTTAACTGC -3'
(R):5'- AGATGTGCTGGGCCTCTATG -3'

Sequencing Primer
(F):5'- TTAAGAGTGCCGACTGCTC -3'
(R):5'- CAGAACTCACTGGTTTGGCTAGAC -3'
Posted On 2019-12-04