Incidental Mutation 'RF013:Mapk6'
ID 603343
Institutional Source Beutler Lab
Gene Symbol Mapk6
Ensembl Gene ENSMUSG00000042688
Gene Name mitogen-activated protein kinase 6
Synonyms Mapk4, D130053K17Rik, ERK3, Prkm6, Mapk63, Prkm4, Erk3, 2610021I23Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.533) question?
Stock # RF013 (G1)
Quality Score 186.468
Status Not validated
Chromosome 9
Chromosomal Location 75369062-75410005 bp(-) (GRCm38)
Type of Mutation frame shift
DNA Base Change (assembly) CCAC to CCACCTCAC at 75388260 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000040315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049355] [ENSMUST00000168937]
AlphaFold Q61532
Predicted Effect probably null
Transcript: ENSMUST00000049355
SMART Domains Protein: ENSMUSP00000040315
Gene: ENSMUSG00000042688

S_TKc 20 316 8.02e-87 SMART
low complexity region 647 670 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000168937
SMART Domains Protein: ENSMUSP00000129024
Gene: ENSMUSG00000042688

S_TKc 20 316 8.02e-87 SMART
low complexity region 647 670 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Ser/Thr protein kinase family, and is most closely related to mitogen-activated protein kinases (MAP kinases). MAP kinases also known as extracellular signal-regulated kinases (ERKs), are activated through protein phosphorylation cascades and act as integration points for multiple biochemical signals. This kinase is localized in the nucleus, and has been reported to be activated in fibroblasts upon treatment with serum or phorbol esters. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show limited fetal growth, reduced serum IGF2 levels, pulmonary hypoplasia and early neonatal death. About 40% of newborns die of acute respiratory failure exhibiting delayed lung maturation, reduced sacculation, atelectasis, and impaired type II pneumocyte differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A G 19: 58,789,294 F28S probably damaging Het
4930435E12Rik T C 16: 38,828,001 T249A probably benign Het
4932438A13Rik TTAT TTATTATTATTATTAGTAT 3: 37,050,757 probably benign Het
Adamts9 A G 6: 92,943,145 V4A possibly damaging Het
AI837181 GGC GGCTGC 19: 5,425,232 probably benign Het
Alk A G 17: 71,895,936 Y1135H probably damaging Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,560,926 probably benign Het
Ano3 A C 2: 110,697,036 L609R probably benign Het
Bicc1 A G 10: 70,935,830 probably null Het
Card6 T C 15: 5,100,142 I591V probably benign Het
Ccdc18 A G 5: 108,220,716 N1235D probably benign Het
Cd109 TTAT TTATTTATTTATCTAT 9: 78,712,531 probably benign Het
Cnpy3 CCT CCTGCT 17: 46,736,744 probably benign Het
Col6a5 GCAGTC GCAGTCTCCAGTC 9: 105,878,597 probably null Het
Cyp8b1 A T 9: 121,915,495 M257K possibly damaging Het
Dbf4 A T 5: 8,397,985 H408Q possibly damaging Het
Defb22 TTGCGGCA TTGCGGCAGAGCTGGCCTGTGCGGCA 2: 152,485,831 probably benign Het
Ercc6l2 A T 13: 63,853,017 T417S probably benign Het
Exd2 AGCCACAG A 12: 80,475,932 probably null Het
Fam171b GC GCAGCATC 2: 83,812,895 probably benign Het
Flvcr2 T A 12: 85,747,186 L112Q probably damaging Het
Flywch1 GTG GTGGGGGGAGGCTACGTACTCACCCACTCCTTTTG 17: 23,762,175 probably null Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 72,270,416 probably benign Het
Gm4884 C A 7: 41,040,809 P43Q probably damaging Het
Gm6588 T A 5: 112,450,071 N161K probably benign Het
Grm8 A G 6: 27,363,780 W579R probably damaging Het
Hsdl2 AG AGCAGCAGCCACAGCTGCCG 4: 59,610,657 probably benign Het
Ivl CTGCTGCTGCTGCTGT C 3: 92,572,343 probably benign Het
Kif18b T C 11: 102,912,366 D506G probably benign Het
Krtap28-10 AGCCAC AGCCACGGCCAC 1: 83,042,135 probably benign Het
Lama1 C A 17: 67,781,062 S1558R Het
Lcmt1 C CCGCGGGGCTT 7: 123,369,836 probably null Het
Lmna A G 3: 88,484,054 V494A probably benign Het
Mboat7 T A 7: 3,691,857 H52L probably damaging Het
Med12l CAG CAGAAG 3: 59,275,966 probably benign Het
Morc2a T A 11: 3,676,191 M225K probably benign Het
Mpdz G A 4: 81,293,592 A1566V possibly damaging Het
Mpi T C 9: 57,548,641 D186G probably benign Het
Mtmr12 C A 15: 12,261,898 N386K probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myo10 T A 15: 25,799,479 M1376K probably damaging Het
Nbas C T 12: 13,279,408 T118I possibly damaging Het
Nedd4l C T 18: 65,209,680 R755C probably damaging Het
Numa1 T C 7: 101,999,780 L906P probably damaging Het
Olfr750 G A 14: 51,071,012 A127V probably damaging Het
Olfr871 T C 9: 20,212,894 S182P probably benign Het
Otop2 G T 11: 115,323,666 R83L probably benign Het
Pmm1 T A 15: 81,957,813 Q62L probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Ptprj A T 2: 90,471,170 L206* probably null Het
Rps19 A AGAAAAT 7: 24,889,180 probably benign Het
Rsrp1 T A 4: 134,923,955 V10E unknown Het
Sh2d6 C T 6: 72,516,388 probably null Het
Six4 TG T 12: 73,103,582 probably null Het
Slc6a15 T A 10: 103,400,216 V264D probably damaging Het
Snapc5 ATGGAAGAAGAGG A 9: 64,182,211 probably benign Het
Sost A T 11: 101,964,132 I117N probably damaging Het
Tbc1d22a AGGTGTGTG A 15: 86,299,774 probably null Het
Tcaf1 C T 6: 42,679,173 V290I probably benign Het
Tcof1 GCA GCACCA 18: 60,835,743 probably benign Het
Tgfbr1 A G 4: 47,353,354 I15V unknown Het
Tmem241 A T 18: 11,983,561 L288Q probably damaging Het
Tnfrsf13b T G 11: 61,141,444 V100G probably benign Het
Trim66 A G 7: 109,460,753 S809P probably damaging Het
Tubb4a C G 17: 57,087,464 G17A possibly damaging Het
Txndc16 A G 14: 45,169,338 V220A probably benign Het
Zan T A 5: 137,391,720 Q4830L unknown Het
Other mutations in Mapk6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Mapk6 APN 9 75388790 missense possibly damaging 0.79
IGL01843:Mapk6 APN 9 75390290 missense probably damaging 1.00
IGL03060:Mapk6 APN 9 75397802 missense probably damaging 0.98
PIT4651001:Mapk6 UTSW 9 75397587 missense possibly damaging 0.90
R0056:Mapk6 UTSW 9 75388816 missense possibly damaging 0.66
R0056:Mapk6 UTSW 9 75388816 missense possibly damaging 0.66
R0659:Mapk6 UTSW 9 75397962 missense probably damaging 0.99
R1673:Mapk6 UTSW 9 75395569 missense probably damaging 1.00
R3419:Mapk6 UTSW 9 75397757 missense probably damaging 1.00
R4798:Mapk6 UTSW 9 75388432 missense probably benign
R5117:Mapk6 UTSW 9 75397735 missense possibly damaging 0.56
R5190:Mapk6 UTSW 9 75388344 missense probably damaging 1.00
R5521:Mapk6 UTSW 9 75393316 intron probably benign
R5579:Mapk6 UTSW 9 75388062 missense possibly damaging 0.63
R6792:Mapk6 UTSW 9 75395548 missense probably damaging 1.00
R7237:Mapk6 UTSW 9 75397613 missense probably damaging 1.00
R9328:Mapk6 UTSW 9 75397970 missense possibly damaging 0.70
R9775:Mapk6 UTSW 9 75388386 missense possibly damaging 0.63
RF044:Mapk6 UTSW 9 75388260 frame shift probably null
RF057:Mapk6 UTSW 9 75388258 frame shift probably null
X0025:Mapk6 UTSW 9 75395508 critical splice donor site probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04