Incidental Mutation 'RF013:Cd109'
ID 603344
Institutional Source Beutler Lab
Gene Symbol Cd109
Ensembl Gene ENSMUSG00000046186
Gene Name CD109 antigen
Synonyms Gov platelet alloantigens, 9930012E15Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # RF013 (G1)
Quality Score 217.468
Status Not validated
Chromosome 9
Chromosomal Location 78615546-78716253 bp(+) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) TTAT to TTATTTATTTATCTAT at 78712531 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093812]
AlphaFold Q8R422
Predicted Effect probably benign
Transcript: ENSMUST00000093812
SMART Domains Protein: ENSMUSP00000091330
Gene: ENSMUSG00000046186

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:A2M_N 129 220 1.5e-16 PFAM
A2M_N_2 470 601 8.89e-32 SMART
A2M 695 786 2.07e-32 SMART
Pfam:Thiol-ester_cl 912 941 2.6e-20 PFAM
Pfam:A2M_comp 961 1197 1.9e-65 PFAM
low complexity region 1265 1275 N/A INTRINSIC
A2M_recep 1311 1395 2.06e-27 SMART
low complexity region 1422 1437 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosyl phosphatidylinositol (GPI)-linked glycoprotein that localizes to the surface of platelets, activated T-cells, and endothelial cells. The protein binds to and negatively regulates signalling by transforming growth factor beta (TGF-beta). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a null mutation display epidermal hyperplasia and thickening, sebaceous gland hyperplasia and transient impairment of hair growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A G 19: 58,789,294 F28S probably damaging Het
4930435E12Rik T C 16: 38,828,001 T249A probably benign Het
4932438A13Rik TTAT TTATTATTATTATTAGTAT 3: 37,050,757 probably benign Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,905,096 probably benign Het
Adamts9 A G 6: 92,943,145 V4A possibly damaging Het
AI837181 GGC GGCTGC 19: 5,425,232 probably benign Het
Alk A G 17: 71,895,936 Y1135H probably damaging Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,560,926 probably benign Het
Ano3 A C 2: 110,697,036 L609R probably benign Het
Bicc1 A G 10: 70,935,830 probably null Het
Card6 T C 15: 5,100,142 I591V probably benign Het
Ccdc18 A G 5: 108,220,716 N1235D probably benign Het
Cnpy3 CCT CCTGCT 17: 46,736,744 probably benign Het
Col6a5 GCAGTC GCAGTCTCCAGTC 9: 105,878,597 probably null Het
Cyb5r4 GACACACTGCCCAGGGA GACACACTGCCCAGGGATGTGACACACACACTGCCCAGGGA 9: 87,040,432 probably benign Het
Cyp8b1 A T 9: 121,915,495 M257K possibly damaging Het
Dbf4 A T 5: 8,397,985 H408Q possibly damaging Het
Defb22 TTGCGGCA TTGCGGCAGAGCTGGCCTGTGCGGCA 2: 152,485,831 probably benign Het
Ercc6l2 A T 13: 63,853,017 T417S probably benign Het
Exd2 AGCCACAG A 12: 80,475,932 probably null Het
Fam171b GC GCAGCATC 2: 83,812,895 probably benign Het
Fam71e1 CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGACGGCTGGATCCTGGATCACTGGGTCTGAGGGAGGA 7: 44,500,520 probably null Het
Flvcr2 T A 12: 85,747,186 L112Q probably damaging Het
Flywch1 GTG GTGGGGGGAGGCTACGTACTCACCCACTCCTTTTG 17: 23,762,175 probably null Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 72,270,416 probably benign Het
Gm4884 C A 7: 41,040,809 P43Q probably damaging Het
Gm6588 T A 5: 112,450,071 N161K probably benign Het
Grm8 A G 6: 27,363,780 W579R probably damaging Het
Hsdl2 AG AGCAGCAGCCACAGCTGCCG 4: 59,610,657 probably benign Het
Ivl CTGCTGCTGCTGCTGT C 3: 92,572,343 probably benign Het
Kif18b T C 11: 102,912,366 D506G probably benign Het
Krtap28-10 AGCCAC AGCCACGGCCAC 1: 83,042,135 probably benign Het
Krtap28-10 GCCACAGCCACCACA GCCACAGCCACCACATCCACAGCCACCACA 1: 83,042,274 probably benign Het
Lama1 C A 17: 67,781,062 S1558R Het
Lcmt1 C CCGCGGGGCTT 7: 123,369,836 probably null Het
Lmna A G 3: 88,484,054 V494A probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,388,260 probably null Het
Mboat7 T A 7: 3,691,857 H52L probably damaging Het
Med12l CAG CAGAAG 3: 59,275,966 probably benign Het
Morc2a T A 11: 3,676,191 M225K probably benign Het
Mpdz G A 4: 81,293,592 A1566V possibly damaging Het
Mpi T C 9: 57,548,641 D186G probably benign Het
Mtmr12 C A 15: 12,261,898 N386K probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myo10 T A 15: 25,799,479 M1376K probably damaging Het
Nbas C T 12: 13,279,408 T118I possibly damaging Het
Nedd4l C T 18: 65,209,680 R755C probably damaging Het
Nefh GACTTGGCCTCACCTGGG GACTTGGCCTCACCTGGGTACTTGGCCTCACCTGGG 11: 4,941,032 probably benign Het
Numa1 T C 7: 101,999,780 L906P probably damaging Het
Olfr750 G A 14: 51,071,012 A127V probably damaging Het
Olfr871 T C 9: 20,212,894 S182P probably benign Het
Otop2 G T 11: 115,323,666 R83L probably benign Het
Pmm1 T A 15: 81,957,813 Q62L probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Ptprj A T 2: 90,471,170 L206* probably null Het
Rassf6 TC TCTGCCTCACTCATGGTCCTGTAGAGCATTGGGGATCC 5: 90,608,941 probably benign Het
Rps19 A AGAAAAT 7: 24,889,180 probably benign Het
Rsrp1 T A 4: 134,923,955 V10E unknown Het
Sh2d6 C T 6: 72,516,388 probably null Het
Six4 TG T 12: 73,103,582 probably null Het
Slc6a15 T A 10: 103,400,216 V264D probably damaging Het
Snapc5 ATGGAAGAAGAGG A 9: 64,182,211 probably benign Het
Sost A T 11: 101,964,132 I117N probably damaging Het
Tbc1d22a AGGTGTGTG A 15: 86,299,774 probably null Het
Tcaf1 C T 6: 42,679,173 V290I probably benign Het
Tcof1 GCA GCACCA 18: 60,835,743 probably benign Het
Tgfbr1 A G 4: 47,353,354 I15V unknown Het
Tmem241 A T 18: 11,983,561 L288Q probably damaging Het
Tnfrsf13b T G 11: 61,141,444 V100G probably benign Het
Trim66 A G 7: 109,460,753 S809P probably damaging Het
Tubb4a C G 17: 57,087,464 G17A possibly damaging Het
Txndc16 A G 14: 45,169,338 V220A probably benign Het
Zan T A 5: 137,391,720 Q4830L unknown Het
Other mutations in Cd109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cd109 APN 9 78616969 missense probably damaging 1.00
IGL00465:Cd109 APN 9 78660934 nonsense probably null
IGL00667:Cd109 APN 9 78684877 missense probably damaging 0.99
IGL01432:Cd109 APN 9 78698123 missense probably benign
IGL01795:Cd109 APN 9 78661765 splice site probably benign
IGL02343:Cd109 APN 9 78688955 splice site probably benign
IGL02450:Cd109 APN 9 78695850 missense possibly damaging 0.83
IGL02699:Cd109 APN 9 78671989 splice site probably benign
IGL02738:Cd109 APN 9 78691299 missense probably damaging 1.00
IGL02797:Cd109 APN 9 78661713 missense probably damaging 0.96
IGL03160:Cd109 APN 9 78661056 splice site probably null
IGL03349:Cd109 APN 9 78636485 missense probably benign 0.34
FR4589:Cd109 UTSW 9 78712529 critical splice acceptor site probably benign
R0048:Cd109 UTSW 9 78680021 missense possibly damaging 0.50
R0060:Cd109 UTSW 9 78703107 missense probably damaging 1.00
R0060:Cd109 UTSW 9 78703107 missense probably damaging 1.00
R0158:Cd109 UTSW 9 78688932 missense possibly damaging 0.49
R0415:Cd109 UTSW 9 78712615 missense probably benign 0.13
R0659:Cd109 UTSW 9 78680170 splice site probably benign
R0709:Cd109 UTSW 9 78671978 missense possibly damaging 0.93
R0840:Cd109 UTSW 9 78664330 missense probably benign 0.04
R0909:Cd109 UTSW 9 78636473 missense probably benign 0.01
R0945:Cd109 UTSW 9 78688941 missense possibly damaging 0.51
R1344:Cd109 UTSW 9 78672550 critical splice acceptor site probably null
R1471:Cd109 UTSW 9 78654587 missense probably damaging 1.00
R1484:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R1570:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R1688:Cd109 UTSW 9 78705091 missense probably benign 0.17
R1773:Cd109 UTSW 9 78703724 missense probably benign 0.21
R1813:Cd109 UTSW 9 78617005 missense probably benign 0.04
R2004:Cd109 UTSW 9 78703762 missense probably benign 0.00
R2083:Cd109 UTSW 9 78667293 missense probably damaging 1.00
R2483:Cd109 UTSW 9 78667357 missense probably damaging 1.00
R2857:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R2858:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R2859:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R2911:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R2912:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R2914:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R2927:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3623:Cd109 UTSW 9 78667357 missense probably damaging 1.00
R3713:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3760:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3762:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3771:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3772:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3773:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3916:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3917:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4117:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4260:Cd109 UTSW 9 78636463 missense possibly damaging 0.67
R4387:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4389:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4526:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4527:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4528:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4700:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4708:Cd109 UTSW 9 78672589 missense probably benign 0.00
R4723:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4750:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4751:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4754:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4755:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4773:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4984:Cd109 UTSW 9 78634677 critical splice donor site probably null
R5259:Cd109 UTSW 9 78710152 missense probably benign 0.30
R5353:Cd109 UTSW 9 78710239 missense probably damaging 1.00
R5440:Cd109 UTSW 9 78680164 critical splice donor site probably null
R5559:Cd109 UTSW 9 78660968 missense probably benign 0.01
R5701:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R5995:Cd109 UTSW 9 78700279 missense probably benign 0.01
R5997:Cd109 UTSW 9 78705062 missense possibly damaging 0.93
R6103:Cd109 UTSW 9 78698314 splice site probably null
R6174:Cd109 UTSW 9 78665546 critical splice donor site probably null
R6410:Cd109 UTSW 9 78657516 missense probably benign 0.01
R6529:Cd109 UTSW 9 78712625 missense probably damaging 1.00
R6655:Cd109 UTSW 9 78684938 missense probably benign 0.44
R6704:Cd109 UTSW 9 78680075 missense probably benign 0.01
R6772:Cd109 UTSW 9 78680810 missense possibly damaging 0.55
R6817:Cd109 UTSW 9 78714955 missense probably benign 0.01
R6903:Cd109 UTSW 9 78636603 missense probably damaging 0.97
R7294:Cd109 UTSW 9 78712635 missense probably damaging 0.97
R7432:Cd109 UTSW 9 78714943 missense possibly damaging 0.85
R7566:Cd109 UTSW 9 78680837 missense probably damaging 1.00
R7767:Cd109 UTSW 9 78710159 missense probably damaging 1.00
R7986:Cd109 UTSW 9 78688766 missense possibly damaging 0.95
R8017:Cd109 UTSW 9 78707546 missense possibly damaging 0.81
R8019:Cd109 UTSW 9 78707546 missense possibly damaging 0.81
R8050:Cd109 UTSW 9 78664351 missense probably benign 0.28
R8225:Cd109 UTSW 9 78661690 missense probably damaging 0.99
R8269:Cd109 UTSW 9 78665682 missense probably benign 0.06
R8479:Cd109 UTSW 9 78667346 nonsense probably null
R8493:Cd109 UTSW 9 78657519 missense probably benign 0.41
R8781:Cd109 UTSW 9 78636647 missense probably damaging 1.00
R8977:Cd109 UTSW 9 78707528 missense probably benign 0.36
R9051:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R9051:Cd109 UTSW 9 78712531 critical splice acceptor site probably benign
R9228:Cd109 UTSW 9 78669760 missense possibly damaging 0.93
R9366:Cd109 UTSW 9 78714993 missense probably benign 0.11
R9430:Cd109 UTSW 9 78667416 critical splice donor site probably null
R9572:Cd109 UTSW 9 78660306 missense probably benign 0.16
R9691:Cd109 UTSW 9 78703792 missense possibly damaging 0.94
R9736:Cd109 UTSW 9 78712636 missense probably damaging 1.00
R9749:Cd109 UTSW 9 78684884 missense probably damaging 1.00
R9751:Cd109 UTSW 9 78698160 missense probably damaging 0.99
R9752:Cd109 UTSW 9 78707552 missense probably benign 0.00
R9789:Cd109 UTSW 9 78634662 missense possibly damaging 0.90
R9797:Cd109 UTSW 9 78671935 missense probably benign 0.04
RF002:Cd109 UTSW 9 78712523 critical splice acceptor site probably benign
RF002:Cd109 UTSW 9 78712528 critical splice acceptor site probably benign
RF003:Cd109 UTSW 9 78712531 critical splice acceptor site probably benign
RF011:Cd109 UTSW 9 78712528 critical splice acceptor site probably benign
RF047:Cd109 UTSW 9 78712527 critical splice acceptor site probably benign
RF060:Cd109 UTSW 9 78712525 critical splice acceptor site probably benign
Z1177:Cd109 UTSW 9 78691313 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CGGGGACTAAGAACCATTCCTC -3'
(R):5'- TTTACAGACAGCCTGCCACC -3'

Sequencing Primer
(F):5'- AAGAACCATTCCTCTGCTATCAGTG -3'
(R):5'- CAAAACTAACCCTGTGAGATGTC -3'
Posted On 2019-12-04