Incidental Mutation 'RF013:Cd109'
ID 603344
Institutional Source Beutler Lab
Gene Symbol Cd109
Ensembl Gene ENSMUSG00000046186
Gene Name CD109 antigen
Synonyms Gov platelet alloantigens, 9930012E15Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # RF013 (G1)
Quality Score 217.468
Status Not validated
Chromosome 9
Chromosomal Location 78522828-78623535 bp(+) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) TTAT to TTATTTATTTATCTAT at 78619813 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093812]
AlphaFold Q8R422
Predicted Effect probably benign
Transcript: ENSMUST00000093812
SMART Domains Protein: ENSMUSP00000091330
Gene: ENSMUSG00000046186

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:A2M_N 129 220 1.5e-16 PFAM
A2M_N_2 470 601 8.89e-32 SMART
A2M 695 786 2.07e-32 SMART
Pfam:Thiol-ester_cl 912 941 2.6e-20 PFAM
Pfam:A2M_comp 961 1197 1.9e-65 PFAM
low complexity region 1265 1275 N/A INTRINSIC
A2M_recep 1311 1395 2.06e-27 SMART
low complexity region 1422 1437 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosyl phosphatidylinositol (GPI)-linked glycoprotein that localizes to the surface of platelets, activated T-cells, and endothelial cells. The protein binds to and negatively regulates signalling by transforming growth factor beta (TGF-beta). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a null mutation display epidermal hyperplasia and thickening, sebaceous gland hyperplasia and transient impairment of hair growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,989,553 (GRCm39) probably benign Het
Adamts9 A G 6: 92,920,126 (GRCm39) V4A possibly damaging Het
AI837181 GGC GGCTGC 19: 5,475,260 (GRCm39) probably benign Het
Alk A G 17: 72,202,931 (GRCm39) Y1135H probably damaging Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,693,979 (GRCm39) probably benign Het
Ano3 A C 2: 110,527,381 (GRCm39) L609R probably benign Het
Bicc1 A G 10: 70,771,660 (GRCm39) probably null Het
Bltp1 TTAT TTATTATTATTATTAGTAT 3: 37,104,906 (GRCm39) probably benign Het
Card6 T C 15: 5,129,624 (GRCm39) I591V probably benign Het
Ccdc121rt2 T A 5: 112,597,937 (GRCm39) N161K probably benign Het
Ccdc18 A G 5: 108,368,582 (GRCm39) N1235D probably benign Het
Cnpy3 CCT CCTGCT 17: 47,047,670 (GRCm39) probably benign Het
Col6a5 GCAGTC GCAGTCTCCAGTC 9: 105,755,796 (GRCm39) probably null Het
Cyb5r4 GACACACTGCCCAGGGA GACACACTGCCCAGGGATGTGACACACACACTGCCCAGGGA 9: 86,922,485 (GRCm39) probably benign Het
Cyp8b1 A T 9: 121,744,561 (GRCm39) M257K possibly damaging Het
Dbf4 A T 5: 8,447,985 (GRCm39) H408Q possibly damaging Het
Defb22 TTGCGGCA TTGCGGCAGAGCTGGCCTGTGCGGCA 2: 152,327,751 (GRCm39) probably benign Het
Ercc6l2 A T 13: 64,000,831 (GRCm39) T417S probably benign Het
Exd2 AGCCACAG A 12: 80,522,706 (GRCm39) probably null Het
Fam171b GC GCAGCATC 2: 83,643,239 (GRCm39) probably benign Het
Flvcr2 T A 12: 85,793,960 (GRCm39) L112Q probably damaging Het
Flywch1 GTG GTGGGGGGAGGCTACGTACTCACCCACTCCTTTTG 17: 23,981,149 (GRCm39) probably null Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 71,314,022 (GRCm39) probably benign Het
Garin5a CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGACGGCTGGATCCTGGATCACTGGGTCTGAGGGAGGA 7: 44,149,944 (GRCm39) probably null Het
Gm4884 C A 7: 40,690,233 (GRCm39) P43Q probably damaging Het
Grm8 A G 6: 27,363,779 (GRCm39) W579R probably damaging Het
Hsdl2 AG AGCAGCAGCCACAGCTGCCG 4: 59,610,657 (GRCm39) probably benign Het
Ivl CTGCTGCTGCTGCTGT C 3: 92,479,650 (GRCm39) probably benign Het
Kif18b T C 11: 102,803,192 (GRCm39) D506G probably benign Het
Krtap28-10 AGCCAC AGCCACGGCCAC 1: 83,019,856 (GRCm39) probably benign Het
Krtap28-10 GCCACAGCCACCACA GCCACAGCCACCACATCCACAGCCACCACA 1: 83,019,995 (GRCm39) probably benign Het
Lama1 C A 17: 68,088,057 (GRCm39) S1558R Het
Lcmt1 C CCGCGGGGCTT 7: 122,969,059 (GRCm39) probably null Het
Lmna A G 3: 88,391,361 (GRCm39) V494A probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,295,542 (GRCm39) probably null Het
Mboat7 T A 7: 3,694,856 (GRCm39) H52L probably damaging Het
Med12l CAG CAGAAG 3: 59,183,387 (GRCm39) probably benign Het
Morc2a T A 11: 3,626,191 (GRCm39) M225K probably benign Het
Mpdz G A 4: 81,211,829 (GRCm39) A1566V possibly damaging Het
Mpi T C 9: 57,455,924 (GRCm39) D186G probably benign Het
Mtmr12 C A 15: 12,261,984 (GRCm39) N386K probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 66,977,182 (GRCm39) probably null Het
Myo10 T A 15: 25,799,565 (GRCm39) M1376K probably damaging Het
Nbas C T 12: 13,329,409 (GRCm39) T118I possibly damaging Het
Nedd4l C T 18: 65,342,751 (GRCm39) R755C probably damaging Het
Nefh GACTTGGCCTCACCTGGG GACTTGGCCTCACCTGGGTACTTGGCCTCACCTGGG 11: 4,891,032 (GRCm39) probably benign Het
Numa1 T C 7: 101,648,987 (GRCm39) L906P probably damaging Het
Or6s1 G A 14: 51,308,469 (GRCm39) A127V probably damaging Het
Or7h8 T C 9: 20,124,190 (GRCm39) S182P probably benign Het
Otop2 G T 11: 115,214,492 (GRCm39) R83L probably benign Het
Pmm1 T A 15: 81,842,014 (GRCm39) Q62L probably damaging Het
Pramel16 C G 4: 143,675,478 (GRCm39) Q449H probably damaging Het
Ptprj A T 2: 90,301,514 (GRCm39) L206* probably null Het
Rassf6 TC TCTGCCTCACTCATGGTCCTGTAGAGCATTGGGGATCC 5: 90,756,800 (GRCm39) probably benign Het
Rps19 A AGAAAAT 7: 24,588,605 (GRCm39) probably benign Het
Rsrp1 T A 4: 134,651,266 (GRCm39) V10E unknown Het
Sh2d6 C T 6: 72,493,371 (GRCm39) probably null Het
Six4 TG T 12: 73,150,356 (GRCm39) probably null Het
Slc6a15 T A 10: 103,236,077 (GRCm39) V264D probably damaging Het
Snapc5 ATGGAAGAAGAGG A 9: 64,089,493 (GRCm39) probably benign Het
Sost A T 11: 101,854,958 (GRCm39) I117N probably damaging Het
Spmip5 A G 19: 58,777,726 (GRCm39) F28S probably damaging Het
Tbc1d22a AGGTGTGTG A 15: 86,183,975 (GRCm39) probably null Het
Tcaf1 C T 6: 42,656,107 (GRCm39) V290I probably benign Het
Tcof1 GCA GCACCA 18: 60,968,815 (GRCm39) probably benign Het
Tex55 T C 16: 38,648,363 (GRCm39) T249A probably benign Het
Tgfbr1 A G 4: 47,353,354 (GRCm39) I15V unknown Het
Tmem241 A T 18: 12,116,618 (GRCm39) L288Q probably damaging Het
Tnfrsf13b T G 11: 61,032,270 (GRCm39) V100G probably benign Het
Trim66 A G 7: 109,059,960 (GRCm39) S809P probably damaging Het
Tubb4a C G 17: 57,394,464 (GRCm39) G17A possibly damaging Het
Txndc16 A G 14: 45,406,795 (GRCm39) V220A probably benign Het
Zan T A 5: 137,389,982 (GRCm39) Q4830L unknown Het
Other mutations in Cd109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cd109 APN 9 78,524,251 (GRCm39) missense probably damaging 1.00
IGL00465:Cd109 APN 9 78,568,216 (GRCm39) nonsense probably null
IGL00667:Cd109 APN 9 78,592,159 (GRCm39) missense probably damaging 0.99
IGL01432:Cd109 APN 9 78,605,405 (GRCm39) missense probably benign
IGL01795:Cd109 APN 9 78,569,047 (GRCm39) splice site probably benign
IGL02343:Cd109 APN 9 78,596,237 (GRCm39) splice site probably benign
IGL02450:Cd109 APN 9 78,603,132 (GRCm39) missense possibly damaging 0.83
IGL02699:Cd109 APN 9 78,579,271 (GRCm39) splice site probably benign
IGL02738:Cd109 APN 9 78,598,581 (GRCm39) missense probably damaging 1.00
IGL02797:Cd109 APN 9 78,568,995 (GRCm39) missense probably damaging 0.96
IGL03160:Cd109 APN 9 78,568,338 (GRCm39) splice site probably null
IGL03349:Cd109 APN 9 78,543,767 (GRCm39) missense probably benign 0.34
FR4589:Cd109 UTSW 9 78,619,811 (GRCm39) critical splice acceptor site probably benign
R0048:Cd109 UTSW 9 78,587,303 (GRCm39) missense possibly damaging 0.50
R0060:Cd109 UTSW 9 78,610,389 (GRCm39) missense probably damaging 1.00
R0060:Cd109 UTSW 9 78,610,389 (GRCm39) missense probably damaging 1.00
R0158:Cd109 UTSW 9 78,596,214 (GRCm39) missense possibly damaging 0.49
R0415:Cd109 UTSW 9 78,619,897 (GRCm39) missense probably benign 0.13
R0659:Cd109 UTSW 9 78,587,452 (GRCm39) splice site probably benign
R0709:Cd109 UTSW 9 78,579,260 (GRCm39) missense possibly damaging 0.93
R0840:Cd109 UTSW 9 78,571,612 (GRCm39) missense probably benign 0.04
R0909:Cd109 UTSW 9 78,543,755 (GRCm39) missense probably benign 0.01
R0945:Cd109 UTSW 9 78,596,223 (GRCm39) missense possibly damaging 0.51
R1344:Cd109 UTSW 9 78,579,832 (GRCm39) critical splice acceptor site probably null
R1471:Cd109 UTSW 9 78,561,869 (GRCm39) missense probably damaging 1.00
R1484:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R1570:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R1688:Cd109 UTSW 9 78,612,373 (GRCm39) missense probably benign 0.17
R1773:Cd109 UTSW 9 78,611,006 (GRCm39) missense probably benign 0.21
R1813:Cd109 UTSW 9 78,524,287 (GRCm39) missense probably benign 0.04
R2004:Cd109 UTSW 9 78,611,044 (GRCm39) missense probably benign 0.00
R2083:Cd109 UTSW 9 78,574,575 (GRCm39) missense probably damaging 1.00
R2483:Cd109 UTSW 9 78,574,639 (GRCm39) missense probably damaging 1.00
R2857:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R2858:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R2859:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R2911:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R2912:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R2914:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R2927:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R3623:Cd109 UTSW 9 78,574,639 (GRCm39) missense probably damaging 1.00
R3713:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R3760:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R3762:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R3771:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R3772:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R3773:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R3916:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R3917:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4117:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4260:Cd109 UTSW 9 78,543,745 (GRCm39) missense possibly damaging 0.67
R4387:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4389:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4526:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4527:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4528:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4700:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4708:Cd109 UTSW 9 78,579,871 (GRCm39) missense probably benign 0.00
R4723:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4750:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4751:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4754:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4755:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4773:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4984:Cd109 UTSW 9 78,541,959 (GRCm39) critical splice donor site probably null
R5259:Cd109 UTSW 9 78,617,434 (GRCm39) missense probably benign 0.30
R5353:Cd109 UTSW 9 78,617,521 (GRCm39) missense probably damaging 1.00
R5440:Cd109 UTSW 9 78,587,446 (GRCm39) critical splice donor site probably null
R5559:Cd109 UTSW 9 78,568,250 (GRCm39) missense probably benign 0.01
R5701:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R5995:Cd109 UTSW 9 78,607,561 (GRCm39) missense probably benign 0.01
R5997:Cd109 UTSW 9 78,612,344 (GRCm39) missense possibly damaging 0.93
R6103:Cd109 UTSW 9 78,605,596 (GRCm39) splice site probably null
R6174:Cd109 UTSW 9 78,572,828 (GRCm39) critical splice donor site probably null
R6410:Cd109 UTSW 9 78,564,798 (GRCm39) missense probably benign 0.01
R6529:Cd109 UTSW 9 78,619,907 (GRCm39) missense probably damaging 1.00
R6655:Cd109 UTSW 9 78,592,220 (GRCm39) missense probably benign 0.44
R6704:Cd109 UTSW 9 78,587,357 (GRCm39) missense probably benign 0.01
R6772:Cd109 UTSW 9 78,588,092 (GRCm39) missense possibly damaging 0.55
R6817:Cd109 UTSW 9 78,622,237 (GRCm39) missense probably benign 0.01
R6903:Cd109 UTSW 9 78,543,885 (GRCm39) missense probably damaging 0.97
R7294:Cd109 UTSW 9 78,619,917 (GRCm39) missense probably damaging 0.97
R7432:Cd109 UTSW 9 78,622,225 (GRCm39) missense possibly damaging 0.85
R7566:Cd109 UTSW 9 78,588,119 (GRCm39) missense probably damaging 1.00
R7767:Cd109 UTSW 9 78,617,441 (GRCm39) missense probably damaging 1.00
R7986:Cd109 UTSW 9 78,596,048 (GRCm39) missense possibly damaging 0.95
R8017:Cd109 UTSW 9 78,614,828 (GRCm39) missense possibly damaging 0.81
R8019:Cd109 UTSW 9 78,614,828 (GRCm39) missense possibly damaging 0.81
R8050:Cd109 UTSW 9 78,571,633 (GRCm39) missense probably benign 0.28
R8225:Cd109 UTSW 9 78,568,972 (GRCm39) missense probably damaging 0.99
R8269:Cd109 UTSW 9 78,572,964 (GRCm39) missense probably benign 0.06
R8479:Cd109 UTSW 9 78,574,628 (GRCm39) nonsense probably null
R8493:Cd109 UTSW 9 78,564,801 (GRCm39) missense probably benign 0.41
R8781:Cd109 UTSW 9 78,543,929 (GRCm39) missense probably damaging 1.00
R8977:Cd109 UTSW 9 78,614,810 (GRCm39) missense probably benign 0.36
R9051:Cd109 UTSW 9 78,619,813 (GRCm39) critical splice acceptor site probably benign
R9051:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R9228:Cd109 UTSW 9 78,577,042 (GRCm39) missense possibly damaging 0.93
R9366:Cd109 UTSW 9 78,622,275 (GRCm39) missense probably benign 0.11
R9430:Cd109 UTSW 9 78,574,698 (GRCm39) critical splice donor site probably null
R9572:Cd109 UTSW 9 78,567,588 (GRCm39) missense probably benign 0.16
R9691:Cd109 UTSW 9 78,611,074 (GRCm39) missense possibly damaging 0.94
R9736:Cd109 UTSW 9 78,619,918 (GRCm39) missense probably damaging 1.00
R9749:Cd109 UTSW 9 78,592,166 (GRCm39) missense probably damaging 1.00
R9751:Cd109 UTSW 9 78,605,442 (GRCm39) missense probably damaging 0.99
R9752:Cd109 UTSW 9 78,614,834 (GRCm39) missense probably benign 0.00
R9789:Cd109 UTSW 9 78,541,944 (GRCm39) missense possibly damaging 0.90
R9797:Cd109 UTSW 9 78,579,217 (GRCm39) missense probably benign 0.04
RF002:Cd109 UTSW 9 78,619,810 (GRCm39) critical splice acceptor site probably benign
RF002:Cd109 UTSW 9 78,619,805 (GRCm39) critical splice acceptor site probably benign
RF003:Cd109 UTSW 9 78,619,813 (GRCm39) critical splice acceptor site probably benign
RF011:Cd109 UTSW 9 78,619,810 (GRCm39) critical splice acceptor site probably benign
RF047:Cd109 UTSW 9 78,619,809 (GRCm39) critical splice acceptor site probably benign
RF060:Cd109 UTSW 9 78,619,807 (GRCm39) critical splice acceptor site probably benign
Z1177:Cd109 UTSW 9 78,598,595 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CGGGGACTAAGAACCATTCCTC -3'
(R):5'- TTTACAGACAGCCTGCCACC -3'

Sequencing Primer
(F):5'- AAGAACCATTCCTCTGCTATCAGTG -3'
(R):5'- CAAAACTAACCCTGTGAGATGTC -3'
Posted On 2019-12-04