Incidental Mutation 'RF013:Cyb5r4'
ID 603345
Institutional Source Beutler Lab
Gene Symbol Cyb5r4
Ensembl Gene ENSMUSG00000032872
Gene Name cytochrome b5 reductase 4
Synonyms b5/b5r, Ncb5or, B5+B5R, 2810034J18Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # RF013 (G1)
Quality Score 217.468
Status Not validated
Chromosome 9
Chromosomal Location 87022014-87077774 bp(+) (GRCm38)
Type of Mutation small insertion (8 aa in frame mutation)
DNA Base Change (assembly) GACACACTGCCCAGGGA to GACACACTGCCCAGGGATGTGACACACACACTGCCCAGGGA at 87040432 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168529]
AlphaFold Q3TDX8
Predicted Effect probably benign
Transcript: ENSMUST00000168529
SMART Domains Protein: ENSMUSP00000126119
Gene: ENSMUSG00000032872

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
Cyt-b5 57 130 2.56e-26 SMART
Pfam:CS 175 253 4.1e-16 PFAM
Pfam:FAD_binding_6 284 391 4.1e-22 PFAM
Pfam:NAD_binding_1 402 508 4.7e-18 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NCB5OR is a flavohemoprotein that contains functional domains found in both cytochrome b5 (CYB5A; MIM 613218) and CYB5 reductase (CYB5R3; MIM 613213) (Zhu et al., 1999 [PubMed 10611283]).[supplied by OMIM, Jan 2010]
PHENOTYPE: Homozygous null mice exhibit defects in glucose homeostasis and pancreatic abnormalities consistent with symptoms of diabetes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A G 19: 58,789,294 F28S probably damaging Het
4930435E12Rik T C 16: 38,828,001 T249A probably benign Het
4932438A13Rik TTAT TTATTATTATTATTAGTAT 3: 37,050,757 probably benign Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,905,096 probably benign Het
Adamts9 A G 6: 92,943,145 V4A possibly damaging Het
AI837181 GGC GGCTGC 19: 5,425,232 probably benign Het
Alk A G 17: 71,895,936 Y1135H probably damaging Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,560,926 probably benign Het
Ano3 A C 2: 110,697,036 L609R probably benign Het
Bicc1 A G 10: 70,935,830 probably null Het
Card6 T C 15: 5,100,142 I591V probably benign Het
Ccdc18 A G 5: 108,220,716 N1235D probably benign Het
Cd109 TTAT TTATTTATTTATCTAT 9: 78,712,531 probably benign Het
Cnpy3 CCT CCTGCT 17: 46,736,744 probably benign Het
Col6a5 GCAGTC GCAGTCTCCAGTC 9: 105,878,597 probably null Het
Cyp8b1 A T 9: 121,915,495 M257K possibly damaging Het
Dbf4 A T 5: 8,397,985 H408Q possibly damaging Het
Defb22 TTGCGGCA TTGCGGCAGAGCTGGCCTGTGCGGCA 2: 152,485,831 probably benign Het
Ercc6l2 A T 13: 63,853,017 T417S probably benign Het
Exd2 AGCCACAG A 12: 80,475,932 probably null Het
Fam171b GC GCAGCATC 2: 83,812,895 probably benign Het
Fam71e1 CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGACGGCTGGATCCTGGATCACTGGGTCTGAGGGAGGA 7: 44,500,520 probably null Het
Flvcr2 T A 12: 85,747,186 L112Q probably damaging Het
Flywch1 GTG GTGGGGGGAGGCTACGTACTCACCCACTCCTTTTG 17: 23,762,175 probably null Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 72,270,416 probably benign Het
Gm4884 C A 7: 41,040,809 P43Q probably damaging Het
Gm6588 T A 5: 112,450,071 N161K probably benign Het
Grm8 A G 6: 27,363,780 W579R probably damaging Het
Hsdl2 AG AGCAGCAGCCACAGCTGCCG 4: 59,610,657 probably benign Het
Ivl CTGCTGCTGCTGCTGT C 3: 92,572,343 probably benign Het
Kif18b T C 11: 102,912,366 D506G probably benign Het
Krtap28-10 AGCCAC AGCCACGGCCAC 1: 83,042,135 probably benign Het
Krtap28-10 GCCACAGCCACCACA GCCACAGCCACCACATCCACAGCCACCACA 1: 83,042,274 probably benign Het
Lama1 C A 17: 67,781,062 S1558R Het
Lcmt1 C CCGCGGGGCTT 7: 123,369,836 probably null Het
Lmna A G 3: 88,484,054 V494A probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,388,260 probably null Het
Mboat7 T A 7: 3,691,857 H52L probably damaging Het
Med12l CAG CAGAAG 3: 59,275,966 probably benign Het
Morc2a T A 11: 3,676,191 M225K probably benign Het
Mpdz G A 4: 81,293,592 A1566V possibly damaging Het
Mpi T C 9: 57,548,641 D186G probably benign Het
Mtmr12 C A 15: 12,261,898 N386K probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myo10 T A 15: 25,799,479 M1376K probably damaging Het
Nbas C T 12: 13,279,408 T118I possibly damaging Het
Nedd4l C T 18: 65,209,680 R755C probably damaging Het
Nefh GACTTGGCCTCACCTGGG GACTTGGCCTCACCTGGGTACTTGGCCTCACCTGGG 11: 4,941,032 probably benign Het
Numa1 T C 7: 101,999,780 L906P probably damaging Het
Olfr750 G A 14: 51,071,012 A127V probably damaging Het
Olfr871 T C 9: 20,212,894 S182P probably benign Het
Otop2 G T 11: 115,323,666 R83L probably benign Het
Pmm1 T A 15: 81,957,813 Q62L probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Ptprj A T 2: 90,471,170 L206* probably null Het
Rassf6 TC TCTGCCTCACTCATGGTCCTGTAGAGCATTGGGGATCC 5: 90,608,941 probably benign Het
Rps19 A AGAAAAT 7: 24,889,180 probably benign Het
Rsrp1 T A 4: 134,923,955 V10E unknown Het
Sh2d6 C T 6: 72,516,388 probably null Het
Six4 TG T 12: 73,103,582 probably null Het
Slc6a15 T A 10: 103,400,216 V264D probably damaging Het
Snapc5 ATGGAAGAAGAGG A 9: 64,182,211 probably benign Het
Sost A T 11: 101,964,132 I117N probably damaging Het
Tbc1d22a AGGTGTGTG A 15: 86,299,774 probably null Het
Tcaf1 C T 6: 42,679,173 V290I probably benign Het
Tcof1 GCA GCACCA 18: 60,835,743 probably benign Het
Tgfbr1 A G 4: 47,353,354 I15V unknown Het
Tmem241 A T 18: 11,983,561 L288Q probably damaging Het
Tnfrsf13b T G 11: 61,141,444 V100G probably benign Het
Trim66 A G 7: 109,460,753 S809P probably damaging Het
Tubb4a C G 17: 57,087,464 G17A possibly damaging Het
Txndc16 A G 14: 45,169,338 V220A probably benign Het
Zan T A 5: 137,391,720 Q4830L unknown Het
Other mutations in Cyb5r4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01833:Cyb5r4 APN 9 87059452 critical splice donor site probably null
cello UTSW 9 87029538 nonsense probably null
viol UTSW 9 87059077 critical splice donor site probably null
PIT1430001:Cyb5r4 UTSW 9 87038738 missense probably benign
R0040:Cyb5r4 UTSW 9 87066742 splice site probably null
R0373:Cyb5r4 UTSW 9 87027040 missense probably damaging 0.99
R0755:Cyb5r4 UTSW 9 87029572 missense probably damaging 1.00
R1381:Cyb5r4 UTSW 9 87022233 missense probably benign 0.03
R1488:Cyb5r4 UTSW 9 87029538 nonsense probably null
R1510:Cyb5r4 UTSW 9 87066643 intron probably benign
R1856:Cyb5r4 UTSW 9 87022209 missense possibly damaging 0.61
R1857:Cyb5r4 UTSW 9 87041279 missense probably benign 0.00
R1858:Cyb5r4 UTSW 9 87041279 missense probably benign 0.00
R1870:Cyb5r4 UTSW 9 87040409 missense probably benign 0.00
R1876:Cyb5r4 UTSW 9 87055814 missense probably damaging 1.00
R1959:Cyb5r4 UTSW 9 87055849 missense possibly damaging 0.82
R2036:Cyb5r4 UTSW 9 87042879 splice site probably benign
R2895:Cyb5r4 UTSW 9 87040399 nonsense probably null
R4226:Cyb5r4 UTSW 9 87057229 missense probably damaging 0.99
R4655:Cyb5r4 UTSW 9 87059429 missense probably benign 0.01
R4971:Cyb5r4 UTSW 9 87057171 missense possibly damaging 0.80
R5038:Cyb5r4 UTSW 9 87059077 critical splice donor site probably null
R5155:Cyb5r4 UTSW 9 87040403 missense probably benign 0.08
R5187:Cyb5r4 UTSW 9 87026948 missense possibly damaging 0.92
R5654:Cyb5r4 UTSW 9 87047480 missense probably damaging 0.98
R5659:Cyb5r4 UTSW 9 87055828 missense probably benign 0.22
R5926:Cyb5r4 UTSW 9 87057261 missense probably benign 0.04
R6083:Cyb5r4 UTSW 9 87057168 missense probably damaging 1.00
R6610:Cyb5r4 UTSW 9 87059417 missense probably benign
R7311:Cyb5r4 UTSW 9 87055782 missense probably damaging 1.00
R7662:Cyb5r4 UTSW 9 87027038 missense possibly damaging 0.83
R7748:Cyb5r4 UTSW 9 87032381 missense probably damaging 1.00
R8171:Cyb5r4 UTSW 9 87042810 missense possibly damaging 0.81
R8253:Cyb5r4 UTSW 9 87059055 missense probably damaging 1.00
R8369:Cyb5r4 UTSW 9 87040433 missense probably benign 0.00
R8816:Cyb5r4 UTSW 9 87022233 missense probably benign 0.31
RF001:Cyb5r4 UTSW 9 87040416 small insertion probably benign
RF006:Cyb5r4 UTSW 9 87040425 small insertion probably benign
RF006:Cyb5r4 UTSW 9 87040441 small insertion probably benign
RF014:Cyb5r4 UTSW 9 87040415 small insertion probably benign
RF015:Cyb5r4 UTSW 9 87040432 small insertion probably benign
RF015:Cyb5r4 UTSW 9 87040438 small insertion probably benign
RF016:Cyb5r4 UTSW 9 87040425 small insertion probably benign
RF016:Cyb5r4 UTSW 9 87040441 small insertion probably benign
RF016:Cyb5r4 UTSW 9 87040444 small insertion probably benign
RF024:Cyb5r4 UTSW 9 87040435 small insertion probably benign
RF025:Cyb5r4 UTSW 9 87040444 small insertion probably benign
RF026:Cyb5r4 UTSW 9 87040433 small insertion probably benign
RF027:Cyb5r4 UTSW 9 87040431 small insertion probably benign
RF029:Cyb5r4 UTSW 9 87040430 small insertion probably benign
RF029:Cyb5r4 UTSW 9 87040442 small insertion probably benign
RF030:Cyb5r4 UTSW 9 87040409 small insertion probably benign
RF030:Cyb5r4 UTSW 9 87040415 small insertion probably benign
RF031:Cyb5r4 UTSW 9 87040445 small insertion probably benign
RF032:Cyb5r4 UTSW 9 87040413 small insertion probably benign
RF034:Cyb5r4 UTSW 9 87040417 small insertion probably benign
RF034:Cyb5r4 UTSW 9 87040447 nonsense probably null
RF036:Cyb5r4 UTSW 9 87040430 small insertion probably benign
RF038:Cyb5r4 UTSW 9 87040442 small insertion probably benign
RF040:Cyb5r4 UTSW 9 87040409 small insertion probably benign
RF043:Cyb5r4 UTSW 9 87040411 small insertion probably benign
RF043:Cyb5r4 UTSW 9 87040431 small insertion probably benign
RF045:Cyb5r4 UTSW 9 87040402 nonsense probably null
RF045:Cyb5r4 UTSW 9 87040447 small insertion probably benign
RF052:Cyb5r4 UTSW 9 87040422 small insertion probably benign
RF053:Cyb5r4 UTSW 9 87040422 small insertion probably benign
RF055:Cyb5r4 UTSW 9 87040414 small insertion probably benign
RF055:Cyb5r4 UTSW 9 87040438 small insertion probably benign
RF056:Cyb5r4 UTSW 9 87040410 small insertion probably benign
RF059:Cyb5r4 UTSW 9 87040445 small insertion probably benign
RF060:Cyb5r4 UTSW 9 87040413 small insertion probably benign
RF061:Cyb5r4 UTSW 9 87040435 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CACTGGGAGAGAGTAAGCTTTTG -3'
(R):5'- ATAAATGAGGTACTGCAGTTCGTG -3'

Sequencing Primer
(F):5'- AAAATGCTGGTGACAAGGGTTTCTC -3'
(R):5'- GCAGTTCGTGCGCTAAGC -3'
Posted On 2019-12-04