Incidental Mutation 'RF013:Cyb5r4'
ID 603345
Institutional Source Beutler Lab
Gene Symbol Cyb5r4
Ensembl Gene ENSMUSG00000032872
Gene Name cytochrome b5 reductase 4
Synonyms Ncb5or, 2810034J18Rik, B5+B5R, b5/b5r
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # RF013 (G1)
Quality Score 217.468
Status Not validated
Chromosome 9
Chromosomal Location 86904082-86959827 bp(+) (GRCm39)
Type of Mutation small insertion (8 aa in frame mutation)
DNA Base Change (assembly) GACACACTGCCCAGGGA to GACACACTGCCCAGGGATGTGACACACACACTGCCCAGGGA at 86922485 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168529]
AlphaFold Q3TDX8
Predicted Effect probably benign
Transcript: ENSMUST00000168529
SMART Domains Protein: ENSMUSP00000126119
Gene: ENSMUSG00000032872

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
Cyt-b5 57 130 2.56e-26 SMART
Pfam:CS 175 253 4.1e-16 PFAM
Pfam:FAD_binding_6 284 391 4.1e-22 PFAM
Pfam:NAD_binding_1 402 508 4.7e-18 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NCB5OR is a flavohemoprotein that contains functional domains found in both cytochrome b5 (CYB5A; MIM 613218) and CYB5 reductase (CYB5R3; MIM 613213) (Zhu et al., 1999 [PubMed 10611283]).[supplied by OMIM, Jan 2010]
PHENOTYPE: Homozygous null mice exhibit defects in glucose homeostasis and pancreatic abnormalities consistent with symptoms of diabetes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,989,553 (GRCm39) probably benign Het
Adamts9 A G 6: 92,920,126 (GRCm39) V4A possibly damaging Het
AI837181 GGC GGCTGC 19: 5,475,260 (GRCm39) probably benign Het
Alk A G 17: 72,202,931 (GRCm39) Y1135H probably damaging Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,693,979 (GRCm39) probably benign Het
Ano3 A C 2: 110,527,381 (GRCm39) L609R probably benign Het
Bicc1 A G 10: 70,771,660 (GRCm39) probably null Het
Bltp1 TTAT TTATTATTATTATTAGTAT 3: 37,104,906 (GRCm39) probably benign Het
Card6 T C 15: 5,129,624 (GRCm39) I591V probably benign Het
Ccdc121rt2 T A 5: 112,597,937 (GRCm39) N161K probably benign Het
Ccdc18 A G 5: 108,368,582 (GRCm39) N1235D probably benign Het
Cd109 TTAT TTATTTATTTATCTAT 9: 78,619,813 (GRCm39) probably benign Het
Cnpy3 CCT CCTGCT 17: 47,047,670 (GRCm39) probably benign Het
Col6a5 GCAGTC GCAGTCTCCAGTC 9: 105,755,796 (GRCm39) probably null Het
Cyp8b1 A T 9: 121,744,561 (GRCm39) M257K possibly damaging Het
Dbf4 A T 5: 8,447,985 (GRCm39) H408Q possibly damaging Het
Defb22 TTGCGGCA TTGCGGCAGAGCTGGCCTGTGCGGCA 2: 152,327,751 (GRCm39) probably benign Het
Ercc6l2 A T 13: 64,000,831 (GRCm39) T417S probably benign Het
Exd2 AGCCACAG A 12: 80,522,706 (GRCm39) probably null Het
Fam171b GC GCAGCATC 2: 83,643,239 (GRCm39) probably benign Het
Flvcr2 T A 12: 85,793,960 (GRCm39) L112Q probably damaging Het
Flywch1 GTG GTGGGGGGAGGCTACGTACTCACCCACTCCTTTTG 17: 23,981,149 (GRCm39) probably null Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 71,314,022 (GRCm39) probably benign Het
Garin5a CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGACGGCTGGATCCTGGATCACTGGGTCTGAGGGAGGA 7: 44,149,944 (GRCm39) probably null Het
Gm4884 C A 7: 40,690,233 (GRCm39) P43Q probably damaging Het
Grm8 A G 6: 27,363,779 (GRCm39) W579R probably damaging Het
Hsdl2 AG AGCAGCAGCCACAGCTGCCG 4: 59,610,657 (GRCm39) probably benign Het
Ivl CTGCTGCTGCTGCTGT C 3: 92,479,650 (GRCm39) probably benign Het
Kif18b T C 11: 102,803,192 (GRCm39) D506G probably benign Het
Krtap28-10 AGCCAC AGCCACGGCCAC 1: 83,019,856 (GRCm39) probably benign Het
Krtap28-10 GCCACAGCCACCACA GCCACAGCCACCACATCCACAGCCACCACA 1: 83,019,995 (GRCm39) probably benign Het
Lama1 C A 17: 68,088,057 (GRCm39) S1558R Het
Lcmt1 C CCGCGGGGCTT 7: 122,969,059 (GRCm39) probably null Het
Lmna A G 3: 88,391,361 (GRCm39) V494A probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,295,542 (GRCm39) probably null Het
Mboat7 T A 7: 3,694,856 (GRCm39) H52L probably damaging Het
Med12l CAG CAGAAG 3: 59,183,387 (GRCm39) probably benign Het
Morc2a T A 11: 3,626,191 (GRCm39) M225K probably benign Het
Mpdz G A 4: 81,211,829 (GRCm39) A1566V possibly damaging Het
Mpi T C 9: 57,455,924 (GRCm39) D186G probably benign Het
Mtmr12 C A 15: 12,261,984 (GRCm39) N386K probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 66,977,182 (GRCm39) probably null Het
Myo10 T A 15: 25,799,565 (GRCm39) M1376K probably damaging Het
Nbas C T 12: 13,329,409 (GRCm39) T118I possibly damaging Het
Nedd4l C T 18: 65,342,751 (GRCm39) R755C probably damaging Het
Nefh GACTTGGCCTCACCTGGG GACTTGGCCTCACCTGGGTACTTGGCCTCACCTGGG 11: 4,891,032 (GRCm39) probably benign Het
Numa1 T C 7: 101,648,987 (GRCm39) L906P probably damaging Het
Or6s1 G A 14: 51,308,469 (GRCm39) A127V probably damaging Het
Or7h8 T C 9: 20,124,190 (GRCm39) S182P probably benign Het
Otop2 G T 11: 115,214,492 (GRCm39) R83L probably benign Het
Pmm1 T A 15: 81,842,014 (GRCm39) Q62L probably damaging Het
Pramel16 C G 4: 143,675,478 (GRCm39) Q449H probably damaging Het
Ptprj A T 2: 90,301,514 (GRCm39) L206* probably null Het
Rassf6 TC TCTGCCTCACTCATGGTCCTGTAGAGCATTGGGGATCC 5: 90,756,800 (GRCm39) probably benign Het
Rps19 A AGAAAAT 7: 24,588,605 (GRCm39) probably benign Het
Rsrp1 T A 4: 134,651,266 (GRCm39) V10E unknown Het
Sh2d6 C T 6: 72,493,371 (GRCm39) probably null Het
Six4 TG T 12: 73,150,356 (GRCm39) probably null Het
Slc6a15 T A 10: 103,236,077 (GRCm39) V264D probably damaging Het
Snapc5 ATGGAAGAAGAGG A 9: 64,089,493 (GRCm39) probably benign Het
Sost A T 11: 101,854,958 (GRCm39) I117N probably damaging Het
Spmip5 A G 19: 58,777,726 (GRCm39) F28S probably damaging Het
Tbc1d22a AGGTGTGTG A 15: 86,183,975 (GRCm39) probably null Het
Tcaf1 C T 6: 42,656,107 (GRCm39) V290I probably benign Het
Tcof1 GCA GCACCA 18: 60,968,815 (GRCm39) probably benign Het
Tex55 T C 16: 38,648,363 (GRCm39) T249A probably benign Het
Tgfbr1 A G 4: 47,353,354 (GRCm39) I15V unknown Het
Tmem241 A T 18: 12,116,618 (GRCm39) L288Q probably damaging Het
Tnfrsf13b T G 11: 61,032,270 (GRCm39) V100G probably benign Het
Trim66 A G 7: 109,059,960 (GRCm39) S809P probably damaging Het
Tubb4a C G 17: 57,394,464 (GRCm39) G17A possibly damaging Het
Txndc16 A G 14: 45,406,795 (GRCm39) V220A probably benign Het
Zan T A 5: 137,389,982 (GRCm39) Q4830L unknown Het
Other mutations in Cyb5r4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01833:Cyb5r4 APN 9 86,941,505 (GRCm39) critical splice donor site probably null
cello UTSW 9 86,911,591 (GRCm39) nonsense probably null
viol UTSW 9 86,941,130 (GRCm39) critical splice donor site probably null
PIT1430001:Cyb5r4 UTSW 9 86,920,791 (GRCm39) missense probably benign
R0040:Cyb5r4 UTSW 9 86,948,795 (GRCm39) splice site probably null
R0373:Cyb5r4 UTSW 9 86,909,093 (GRCm39) missense probably damaging 0.99
R0755:Cyb5r4 UTSW 9 86,911,625 (GRCm39) missense probably damaging 1.00
R1381:Cyb5r4 UTSW 9 86,904,286 (GRCm39) missense probably benign 0.03
R1488:Cyb5r4 UTSW 9 86,911,591 (GRCm39) nonsense probably null
R1510:Cyb5r4 UTSW 9 86,948,696 (GRCm39) intron probably benign
R1856:Cyb5r4 UTSW 9 86,904,262 (GRCm39) missense possibly damaging 0.61
R1857:Cyb5r4 UTSW 9 86,923,332 (GRCm39) missense probably benign 0.00
R1858:Cyb5r4 UTSW 9 86,923,332 (GRCm39) missense probably benign 0.00
R1870:Cyb5r4 UTSW 9 86,922,462 (GRCm39) missense probably benign 0.00
R1876:Cyb5r4 UTSW 9 86,937,867 (GRCm39) missense probably damaging 1.00
R1959:Cyb5r4 UTSW 9 86,937,902 (GRCm39) missense possibly damaging 0.82
R2036:Cyb5r4 UTSW 9 86,924,932 (GRCm39) splice site probably benign
R2895:Cyb5r4 UTSW 9 86,922,452 (GRCm39) nonsense probably null
R4226:Cyb5r4 UTSW 9 86,939,282 (GRCm39) missense probably damaging 0.99
R4655:Cyb5r4 UTSW 9 86,941,482 (GRCm39) missense probably benign 0.01
R4971:Cyb5r4 UTSW 9 86,939,224 (GRCm39) missense possibly damaging 0.80
R5038:Cyb5r4 UTSW 9 86,941,130 (GRCm39) critical splice donor site probably null
R5155:Cyb5r4 UTSW 9 86,922,456 (GRCm39) missense probably benign 0.08
R5187:Cyb5r4 UTSW 9 86,909,001 (GRCm39) missense possibly damaging 0.92
R5654:Cyb5r4 UTSW 9 86,929,533 (GRCm39) missense probably damaging 0.98
R5659:Cyb5r4 UTSW 9 86,937,881 (GRCm39) missense probably benign 0.22
R5926:Cyb5r4 UTSW 9 86,939,314 (GRCm39) missense probably benign 0.04
R6083:Cyb5r4 UTSW 9 86,939,221 (GRCm39) missense probably damaging 1.00
R6610:Cyb5r4 UTSW 9 86,941,470 (GRCm39) missense probably benign
R7311:Cyb5r4 UTSW 9 86,937,835 (GRCm39) missense probably damaging 1.00
R7662:Cyb5r4 UTSW 9 86,909,091 (GRCm39) missense possibly damaging 0.83
R7748:Cyb5r4 UTSW 9 86,914,434 (GRCm39) missense probably damaging 1.00
R8171:Cyb5r4 UTSW 9 86,924,863 (GRCm39) missense possibly damaging 0.81
R8253:Cyb5r4 UTSW 9 86,941,108 (GRCm39) missense probably damaging 1.00
R8369:Cyb5r4 UTSW 9 86,922,486 (GRCm39) missense probably benign 0.00
R8816:Cyb5r4 UTSW 9 86,904,286 (GRCm39) missense probably benign 0.31
RF001:Cyb5r4 UTSW 9 86,922,469 (GRCm39) small insertion probably benign
RF006:Cyb5r4 UTSW 9 86,922,494 (GRCm39) small insertion probably benign
RF006:Cyb5r4 UTSW 9 86,922,478 (GRCm39) small insertion probably benign
RF014:Cyb5r4 UTSW 9 86,922,468 (GRCm39) small insertion probably benign
RF015:Cyb5r4 UTSW 9 86,922,491 (GRCm39) small insertion probably benign
RF015:Cyb5r4 UTSW 9 86,922,485 (GRCm39) small insertion probably benign
RF016:Cyb5r4 UTSW 9 86,922,497 (GRCm39) small insertion probably benign
RF016:Cyb5r4 UTSW 9 86,922,494 (GRCm39) small insertion probably benign
RF016:Cyb5r4 UTSW 9 86,922,478 (GRCm39) small insertion probably benign
RF024:Cyb5r4 UTSW 9 86,922,488 (GRCm39) small insertion probably benign
RF025:Cyb5r4 UTSW 9 86,922,497 (GRCm39) small insertion probably benign
RF026:Cyb5r4 UTSW 9 86,922,486 (GRCm39) small insertion probably benign
RF027:Cyb5r4 UTSW 9 86,922,484 (GRCm39) small insertion probably benign
RF029:Cyb5r4 UTSW 9 86,922,495 (GRCm39) small insertion probably benign
RF029:Cyb5r4 UTSW 9 86,922,483 (GRCm39) small insertion probably benign
RF030:Cyb5r4 UTSW 9 86,922,468 (GRCm39) small insertion probably benign
RF030:Cyb5r4 UTSW 9 86,922,462 (GRCm39) small insertion probably benign
RF031:Cyb5r4 UTSW 9 86,922,498 (GRCm39) small insertion probably benign
RF032:Cyb5r4 UTSW 9 86,922,466 (GRCm39) small insertion probably benign
RF034:Cyb5r4 UTSW 9 86,922,500 (GRCm39) nonsense probably null
RF034:Cyb5r4 UTSW 9 86,922,470 (GRCm39) small insertion probably benign
RF036:Cyb5r4 UTSW 9 86,922,483 (GRCm39) small insertion probably benign
RF038:Cyb5r4 UTSW 9 86,922,495 (GRCm39) small insertion probably benign
RF040:Cyb5r4 UTSW 9 86,922,462 (GRCm39) small insertion probably benign
RF043:Cyb5r4 UTSW 9 86,922,484 (GRCm39) small insertion probably benign
RF043:Cyb5r4 UTSW 9 86,922,464 (GRCm39) small insertion probably benign
RF045:Cyb5r4 UTSW 9 86,922,500 (GRCm39) small insertion probably benign
RF045:Cyb5r4 UTSW 9 86,922,455 (GRCm39) nonsense probably null
RF052:Cyb5r4 UTSW 9 86,922,475 (GRCm39) small insertion probably benign
RF053:Cyb5r4 UTSW 9 86,922,475 (GRCm39) small insertion probably benign
RF055:Cyb5r4 UTSW 9 86,922,491 (GRCm39) small insertion probably benign
RF055:Cyb5r4 UTSW 9 86,922,467 (GRCm39) small insertion probably benign
RF056:Cyb5r4 UTSW 9 86,922,463 (GRCm39) small insertion probably benign
RF059:Cyb5r4 UTSW 9 86,922,498 (GRCm39) small insertion probably benign
RF060:Cyb5r4 UTSW 9 86,922,466 (GRCm39) small insertion probably benign
RF061:Cyb5r4 UTSW 9 86,922,488 (GRCm39) small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CACTGGGAGAGAGTAAGCTTTTG -3'
(R):5'- ATAAATGAGGTACTGCAGTTCGTG -3'

Sequencing Primer
(F):5'- AAAATGCTGGTGACAAGGGTTTCTC -3'
(R):5'- GCAGTTCGTGCGCTAAGC -3'
Posted On 2019-12-04