Incidental Mutation 'RF013:Cyp8b1'
ID 603347
Institutional Source Beutler Lab
Gene Symbol Cyp8b1
Ensembl Gene ENSMUSG00000050445
Gene Name cytochrome P450, family 8, subfamily b, polypeptide 1
Synonyms sterol 12-alpha-hydrolase
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.498) question?
Stock # RF013 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 121743422-121745371 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 121744561 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 257 (M257K)
Ref Sequence ENSEMBL: ENSMUSP00000052989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050327] [ENSMUST00000062474] [ENSMUST00000214340]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000050327
SMART Domains Protein: ENSMUSP00000050119
Gene: ENSMUSG00000044534

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
Pfam:7tm_1 62 311 1e-40 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000062474
AA Change: M257K

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000052989
Gene: ENSMUSG00000050445
AA Change: M257K

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
Pfam:p450 32 492 5.7e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214340
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum membrane protein catalyzes the conversion of 7 alpha-hydroxy-4-cholesten-3-one into 7-alpha,12-alpha-dihydroxy-4-cholesten-3-one. The balance between these two steroids determines the relative amounts of cholic acid and chenodeoxycholic acid both of which are secreted in the bile and affect the solubility of cholesterol. This gene is unique among the cytochrome P450 genes in that it is intronless. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele lack synthsesis of cholate (a primary bile acid) and its metabolites and display an increased bile acid pool and alterations in cholesterol metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,989,553 (GRCm39) probably benign Het
Adamts9 A G 6: 92,920,126 (GRCm39) V4A possibly damaging Het
AI837181 GGC GGCTGC 19: 5,475,260 (GRCm39) probably benign Het
Alk A G 17: 72,202,931 (GRCm39) Y1135H probably damaging Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,693,979 (GRCm39) probably benign Het
Ano3 A C 2: 110,527,381 (GRCm39) L609R probably benign Het
Bicc1 A G 10: 70,771,660 (GRCm39) probably null Het
Bltp1 TTAT TTATTATTATTATTAGTAT 3: 37,104,906 (GRCm39) probably benign Het
Card6 T C 15: 5,129,624 (GRCm39) I591V probably benign Het
Ccdc121rt2 T A 5: 112,597,937 (GRCm39) N161K probably benign Het
Ccdc18 A G 5: 108,368,582 (GRCm39) N1235D probably benign Het
Cd109 TTAT TTATTTATTTATCTAT 9: 78,619,813 (GRCm39) probably benign Het
Cnpy3 CCT CCTGCT 17: 47,047,670 (GRCm39) probably benign Het
Col6a5 GCAGTC GCAGTCTCCAGTC 9: 105,755,796 (GRCm39) probably null Het
Cyb5r4 GACACACTGCCCAGGGA GACACACTGCCCAGGGATGTGACACACACACTGCCCAGGGA 9: 86,922,485 (GRCm39) probably benign Het
Dbf4 A T 5: 8,447,985 (GRCm39) H408Q possibly damaging Het
Defb22 TTGCGGCA TTGCGGCAGAGCTGGCCTGTGCGGCA 2: 152,327,751 (GRCm39) probably benign Het
Ercc6l2 A T 13: 64,000,831 (GRCm39) T417S probably benign Het
Exd2 AGCCACAG A 12: 80,522,706 (GRCm39) probably null Het
Fam171b GC GCAGCATC 2: 83,643,239 (GRCm39) probably benign Het
Flvcr2 T A 12: 85,793,960 (GRCm39) L112Q probably damaging Het
Flywch1 GTG GTGGGGGGAGGCTACGTACTCACCCACTCCTTTTG 17: 23,981,149 (GRCm39) probably null Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 71,314,022 (GRCm39) probably benign Het
Garin5a CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGACGGCTGGATCCTGGATCACTGGGTCTGAGGGAGGA 7: 44,149,944 (GRCm39) probably null Het
Gm4884 C A 7: 40,690,233 (GRCm39) P43Q probably damaging Het
Grm8 A G 6: 27,363,779 (GRCm39) W579R probably damaging Het
Hsdl2 AG AGCAGCAGCCACAGCTGCCG 4: 59,610,657 (GRCm39) probably benign Het
Ivl CTGCTGCTGCTGCTGT C 3: 92,479,650 (GRCm39) probably benign Het
Kif18b T C 11: 102,803,192 (GRCm39) D506G probably benign Het
Krtap28-10 AGCCAC AGCCACGGCCAC 1: 83,019,856 (GRCm39) probably benign Het
Krtap28-10 GCCACAGCCACCACA GCCACAGCCACCACATCCACAGCCACCACA 1: 83,019,995 (GRCm39) probably benign Het
Lama1 C A 17: 68,088,057 (GRCm39) S1558R Het
Lcmt1 C CCGCGGGGCTT 7: 122,969,059 (GRCm39) probably null Het
Lmna A G 3: 88,391,361 (GRCm39) V494A probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,295,542 (GRCm39) probably null Het
Mboat7 T A 7: 3,694,856 (GRCm39) H52L probably damaging Het
Med12l CAG CAGAAG 3: 59,183,387 (GRCm39) probably benign Het
Morc2a T A 11: 3,626,191 (GRCm39) M225K probably benign Het
Mpdz G A 4: 81,211,829 (GRCm39) A1566V possibly damaging Het
Mpi T C 9: 57,455,924 (GRCm39) D186G probably benign Het
Mtmr12 C A 15: 12,261,984 (GRCm39) N386K probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 66,977,182 (GRCm39) probably null Het
Myo10 T A 15: 25,799,565 (GRCm39) M1376K probably damaging Het
Nbas C T 12: 13,329,409 (GRCm39) T118I possibly damaging Het
Nedd4l C T 18: 65,342,751 (GRCm39) R755C probably damaging Het
Nefh GACTTGGCCTCACCTGGG GACTTGGCCTCACCTGGGTACTTGGCCTCACCTGGG 11: 4,891,032 (GRCm39) probably benign Het
Numa1 T C 7: 101,648,987 (GRCm39) L906P probably damaging Het
Or6s1 G A 14: 51,308,469 (GRCm39) A127V probably damaging Het
Or7h8 T C 9: 20,124,190 (GRCm39) S182P probably benign Het
Otop2 G T 11: 115,214,492 (GRCm39) R83L probably benign Het
Pmm1 T A 15: 81,842,014 (GRCm39) Q62L probably damaging Het
Pramel16 C G 4: 143,675,478 (GRCm39) Q449H probably damaging Het
Ptprj A T 2: 90,301,514 (GRCm39) L206* probably null Het
Rassf6 TC TCTGCCTCACTCATGGTCCTGTAGAGCATTGGGGATCC 5: 90,756,800 (GRCm39) probably benign Het
Rps19 A AGAAAAT 7: 24,588,605 (GRCm39) probably benign Het
Rsrp1 T A 4: 134,651,266 (GRCm39) V10E unknown Het
Sh2d6 C T 6: 72,493,371 (GRCm39) probably null Het
Six4 TG T 12: 73,150,356 (GRCm39) probably null Het
Slc6a15 T A 10: 103,236,077 (GRCm39) V264D probably damaging Het
Snapc5 ATGGAAGAAGAGG A 9: 64,089,493 (GRCm39) probably benign Het
Sost A T 11: 101,854,958 (GRCm39) I117N probably damaging Het
Spmip5 A G 19: 58,777,726 (GRCm39) F28S probably damaging Het
Tbc1d22a AGGTGTGTG A 15: 86,183,975 (GRCm39) probably null Het
Tcaf1 C T 6: 42,656,107 (GRCm39) V290I probably benign Het
Tcof1 GCA GCACCA 18: 60,968,815 (GRCm39) probably benign Het
Tex55 T C 16: 38,648,363 (GRCm39) T249A probably benign Het
Tgfbr1 A G 4: 47,353,354 (GRCm39) I15V unknown Het
Tmem241 A T 18: 12,116,618 (GRCm39) L288Q probably damaging Het
Tnfrsf13b T G 11: 61,032,270 (GRCm39) V100G probably benign Het
Trim66 A G 7: 109,059,960 (GRCm39) S809P probably damaging Het
Tubb4a C G 17: 57,394,464 (GRCm39) G17A possibly damaging Het
Txndc16 A G 14: 45,406,795 (GRCm39) V220A probably benign Het
Zan T A 5: 137,389,982 (GRCm39) Q4830L unknown Het
Other mutations in Cyp8b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Cyp8b1 APN 9 121,744,061 (GRCm39) missense probably damaging 0.98
IGL01874:Cyp8b1 APN 9 121,744,969 (GRCm39) missense possibly damaging 0.71
IGL02004:Cyp8b1 APN 9 121,744,058 (GRCm39) missense probably benign 0.01
IGL02218:Cyp8b1 APN 9 121,744,183 (GRCm39) missense probably damaging 1.00
IGL02606:Cyp8b1 APN 9 121,744,801 (GRCm39) missense probably damaging 1.00
IGL02724:Cyp8b1 APN 9 121,744,453 (GRCm39) missense probably benign 0.12
IGL02796:Cyp8b1 UTSW 9 121,744,564 (GRCm39) missense probably benign
R1052:Cyp8b1 UTSW 9 121,744,348 (GRCm39) missense possibly damaging 0.67
R1223:Cyp8b1 UTSW 9 121,744,070 (GRCm39) missense possibly damaging 0.71
R1572:Cyp8b1 UTSW 9 121,744,024 (GRCm39) missense possibly damaging 0.94
R1639:Cyp8b1 UTSW 9 121,743,956 (GRCm39) missense probably benign 0.01
R3833:Cyp8b1 UTSW 9 121,745,109 (GRCm39) missense probably benign 0.00
R3938:Cyp8b1 UTSW 9 121,744,684 (GRCm39) missense probably benign 0.05
R4151:Cyp8b1 UTSW 9 121,745,134 (GRCm39) missense probably damaging 1.00
R4615:Cyp8b1 UTSW 9 121,745,164 (GRCm39) nonsense probably null
R4625:Cyp8b1 UTSW 9 121,744,651 (GRCm39) missense probably damaging 0.99
R5327:Cyp8b1 UTSW 9 121,743,950 (GRCm39) missense probably damaging 0.99
R6391:Cyp8b1 UTSW 9 121,744,864 (GRCm39) nonsense probably null
R6998:Cyp8b1 UTSW 9 121,745,059 (GRCm39) missense probably benign
R7086:Cyp8b1 UTSW 9 121,744,355 (GRCm39) missense probably benign 0.02
R7162:Cyp8b1 UTSW 9 121,744,777 (GRCm39) missense probably damaging 0.99
R7210:Cyp8b1 UTSW 9 121,744,246 (GRCm39) missense probably damaging 1.00
R7223:Cyp8b1 UTSW 9 121,744,163 (GRCm39) missense probably damaging 1.00
R8352:Cyp8b1 UTSW 9 121,744,997 (GRCm39) missense probably damaging 0.97
R8392:Cyp8b1 UTSW 9 121,744,300 (GRCm39) missense probably damaging 0.98
R8452:Cyp8b1 UTSW 9 121,744,997 (GRCm39) missense probably damaging 0.97
R8672:Cyp8b1 UTSW 9 121,743,986 (GRCm39) missense probably benign 0.00
R8897:Cyp8b1 UTSW 9 121,745,358 (GRCm39) start gained probably benign
R9484:Cyp8b1 UTSW 9 121,744,983 (GRCm39) missense probably benign 0.00
R9764:Cyp8b1 UTSW 9 121,744,294 (GRCm39) missense probably benign 0.03
Z1177:Cyp8b1 UTSW 9 121,745,212 (GRCm39) missense probably damaging 1.00
Z1177:Cyp8b1 UTSW 9 121,744,597 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AACGACTTCTTGGCTTCCAG -3'
(R):5'- CAAGCAGCAAGACCTGGATG -3'

Sequencing Primer
(F):5'- CTTACCCATGACCCTGGTGG -3'
(R):5'- ATGAGGCCGATGAGCTGTTCAG -3'
Posted On 2019-12-04