Incidental Mutation 'RF013:Cyp8b1'
ID 603347
Institutional Source Beutler Lab
Gene Symbol Cyp8b1
Ensembl Gene ENSMUSG00000050445
Gene Name cytochrome P450, family 8, subfamily b, polypeptide 1
Synonyms sterol 12-alpha-hydrolase
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.370) question?
Stock # RF013 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 121914356-121916305 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 121915495 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 257 (M257K)
Ref Sequence ENSEMBL: ENSMUSP00000052989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050327] [ENSMUST00000062474] [ENSMUST00000214340]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000050327
SMART Domains Protein: ENSMUSP00000050119
Gene: ENSMUSG00000044534

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
Pfam:7tm_1 62 311 1e-40 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000062474
AA Change: M257K

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000052989
Gene: ENSMUSG00000050445
AA Change: M257K

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
Pfam:p450 32 492 5.7e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214340
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum membrane protein catalyzes the conversion of 7 alpha-hydroxy-4-cholesten-3-one into 7-alpha,12-alpha-dihydroxy-4-cholesten-3-one. The balance between these two steroids determines the relative amounts of cholic acid and chenodeoxycholic acid both of which are secreted in the bile and affect the solubility of cholesterol. This gene is unique among the cytochrome P450 genes in that it is intronless. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele lack synthsesis of cholate (a primary bile acid) and its metabolites and display an increased bile acid pool and alterations in cholesterol metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A G 19: 58,789,294 F28S probably damaging Het
4930435E12Rik T C 16: 38,828,001 T249A probably benign Het
4932438A13Rik TTAT TTATTATTATTATTAGTAT 3: 37,050,757 probably benign Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,905,096 probably benign Het
Adamts9 A G 6: 92,943,145 V4A possibly damaging Het
AI837181 GGC GGCTGC 19: 5,425,232 probably benign Het
Alk A G 17: 71,895,936 Y1135H probably damaging Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,560,926 probably benign Het
Ano3 A C 2: 110,697,036 L609R probably benign Het
Bicc1 A G 10: 70,935,830 probably null Het
Card6 T C 15: 5,100,142 I591V probably benign Het
Ccdc18 A G 5: 108,220,716 N1235D probably benign Het
Cd109 TTAT TTATTTATTTATCTAT 9: 78,712,531 probably benign Het
Cnpy3 CCT CCTGCT 17: 46,736,744 probably benign Het
Col6a5 GCAGTC GCAGTCTCCAGTC 9: 105,878,597 probably null Het
Cyb5r4 GACACACTGCCCAGGGA GACACACTGCCCAGGGATGTGACACACACACTGCCCAGGGA 9: 87,040,432 probably benign Het
Dbf4 A T 5: 8,397,985 H408Q possibly damaging Het
Defb22 TTGCGGCA TTGCGGCAGAGCTGGCCTGTGCGGCA 2: 152,485,831 probably benign Het
Ercc6l2 A T 13: 63,853,017 T417S probably benign Het
Exd2 AGCCACAG A 12: 80,475,932 probably null Het
Fam171b GC GCAGCATC 2: 83,812,895 probably benign Het
Fam71e1 CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGACGGCTGGATCCTGGATCACTGGGTCTGAGGGAGGA 7: 44,500,520 probably null Het
Flvcr2 T A 12: 85,747,186 L112Q probably damaging Het
Flywch1 GTG GTGGGGGGAGGCTACGTACTCACCCACTCCTTTTG 17: 23,762,175 probably null Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 72,270,416 probably benign Het
Gm4884 C A 7: 41,040,809 P43Q probably damaging Het
Gm6588 T A 5: 112,450,071 N161K probably benign Het
Grm8 A G 6: 27,363,780 W579R probably damaging Het
Hsdl2 AG AGCAGCAGCCACAGCTGCCG 4: 59,610,657 probably benign Het
Ivl CTGCTGCTGCTGCTGT C 3: 92,572,343 probably benign Het
Kif18b T C 11: 102,912,366 D506G probably benign Het
Krtap28-10 AGCCAC AGCCACGGCCAC 1: 83,042,135 probably benign Het
Krtap28-10 GCCACAGCCACCACA GCCACAGCCACCACATCCACAGCCACCACA 1: 83,042,274 probably benign Het
Lama1 C A 17: 67,781,062 S1558R Het
Lcmt1 C CCGCGGGGCTT 7: 123,369,836 probably null Het
Lmna A G 3: 88,484,054 V494A probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,388,260 probably null Het
Mboat7 T A 7: 3,691,857 H52L probably damaging Het
Med12l CAG CAGAAG 3: 59,275,966 probably benign Het
Morc2a T A 11: 3,676,191 M225K probably benign Het
Mpdz G A 4: 81,293,592 A1566V possibly damaging Het
Mpi T C 9: 57,548,641 D186G probably benign Het
Mtmr12 C A 15: 12,261,898 N386K probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myo10 T A 15: 25,799,479 M1376K probably damaging Het
Nbas C T 12: 13,279,408 T118I possibly damaging Het
Nedd4l C T 18: 65,209,680 R755C probably damaging Het
Nefh GACTTGGCCTCACCTGGG GACTTGGCCTCACCTGGGTACTTGGCCTCACCTGGG 11: 4,941,032 probably benign Het
Numa1 T C 7: 101,999,780 L906P probably damaging Het
Olfr750 G A 14: 51,071,012 A127V probably damaging Het
Olfr871 T C 9: 20,212,894 S182P probably benign Het
Otop2 G T 11: 115,323,666 R83L probably benign Het
Pmm1 T A 15: 81,957,813 Q62L probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Ptprj A T 2: 90,471,170 L206* probably null Het
Rassf6 TC TCTGCCTCACTCATGGTCCTGTAGAGCATTGGGGATCC 5: 90,608,941 probably benign Het
Rps19 A AGAAAAT 7: 24,889,180 probably benign Het
Rsrp1 T A 4: 134,923,955 V10E unknown Het
Sh2d6 C T 6: 72,516,388 probably null Het
Six4 TG T 12: 73,103,582 probably null Het
Slc6a15 T A 10: 103,400,216 V264D probably damaging Het
Snapc5 ATGGAAGAAGAGG A 9: 64,182,211 probably benign Het
Sost A T 11: 101,964,132 I117N probably damaging Het
Tbc1d22a AGGTGTGTG A 15: 86,299,774 probably null Het
Tcaf1 C T 6: 42,679,173 V290I probably benign Het
Tcof1 GCA GCACCA 18: 60,835,743 probably benign Het
Tgfbr1 A G 4: 47,353,354 I15V unknown Het
Tmem241 A T 18: 11,983,561 L288Q probably damaging Het
Tnfrsf13b T G 11: 61,141,444 V100G probably benign Het
Trim66 A G 7: 109,460,753 S809P probably damaging Het
Tubb4a C G 17: 57,087,464 G17A possibly damaging Het
Txndc16 A G 14: 45,169,338 V220A probably benign Het
Zan T A 5: 137,391,720 Q4830L unknown Het
Other mutations in Cyp8b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Cyp8b1 APN 9 121914995 missense probably damaging 0.98
IGL01874:Cyp8b1 APN 9 121915903 missense possibly damaging 0.71
IGL02004:Cyp8b1 APN 9 121914992 missense probably benign 0.01
IGL02218:Cyp8b1 APN 9 121915117 missense probably damaging 1.00
IGL02606:Cyp8b1 APN 9 121915735 missense probably damaging 1.00
IGL02724:Cyp8b1 APN 9 121915387 missense probably benign 0.12
IGL02796:Cyp8b1 UTSW 9 121915498 missense probably benign
R1052:Cyp8b1 UTSW 9 121915282 missense possibly damaging 0.67
R1223:Cyp8b1 UTSW 9 121915004 missense possibly damaging 0.71
R1572:Cyp8b1 UTSW 9 121914958 missense possibly damaging 0.94
R1639:Cyp8b1 UTSW 9 121914890 missense probably benign 0.01
R3833:Cyp8b1 UTSW 9 121916043 missense probably benign 0.00
R3938:Cyp8b1 UTSW 9 121915618 missense probably benign 0.05
R4151:Cyp8b1 UTSW 9 121916068 missense probably damaging 1.00
R4615:Cyp8b1 UTSW 9 121916098 nonsense probably null
R4625:Cyp8b1 UTSW 9 121915585 missense probably damaging 0.99
R5327:Cyp8b1 UTSW 9 121914884 missense probably damaging 0.99
R6391:Cyp8b1 UTSW 9 121915798 nonsense probably null
R6998:Cyp8b1 UTSW 9 121915993 missense probably benign
R7086:Cyp8b1 UTSW 9 121915289 missense probably benign 0.02
R7162:Cyp8b1 UTSW 9 121915711 missense probably damaging 0.99
R7210:Cyp8b1 UTSW 9 121915180 missense probably damaging 1.00
R7223:Cyp8b1 UTSW 9 121915097 missense probably damaging 1.00
R8352:Cyp8b1 UTSW 9 121915931 missense probably damaging 0.97
R8392:Cyp8b1 UTSW 9 121915234 missense probably damaging 0.98
R8452:Cyp8b1 UTSW 9 121915931 missense probably damaging 0.97
R8672:Cyp8b1 UTSW 9 121914920 missense probably benign 0.00
R8897:Cyp8b1 UTSW 9 121916292 start gained probably benign
R9484:Cyp8b1 UTSW 9 121915917 missense probably benign 0.00
R9764:Cyp8b1 UTSW 9 121915228 missense probably benign 0.03
Z1177:Cyp8b1 UTSW 9 121915531 missense probably benign 0.06
Z1177:Cyp8b1 UTSW 9 121916146 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACGACTTCTTGGCTTCCAG -3'
(R):5'- CAAGCAGCAAGACCTGGATG -3'

Sequencing Primer
(F):5'- CTTACCCATGACCCTGGTGG -3'
(R):5'- ATGAGGCCGATGAGCTGTTCAG -3'
Posted On 2019-12-04