Incidental Mutation 'RF013:Bicc1'
ID 603348
Institutional Source Beutler Lab
Gene Symbol Bicc1
Ensembl Gene ENSMUSG00000014329
Gene Name BicC family RNA binding protein 1
Synonyms Bic-C, jcpk
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # RF013 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 70758662-70995530 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 70771660 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014473] [ENSMUST00000131445] [ENSMUST00000143791]
AlphaFold Q99MQ1
Predicted Effect probably null
Transcript: ENSMUST00000014473
SMART Domains Protein: ENSMUSP00000014473
Gene: ENSMUSG00000014329

DomainStartEndE-ValueType
KH 47 129 2.69e0 SMART
KH 133 206 6.24e-18 SMART
KH 285 355 1.25e-8 SMART
low complexity region 384 402 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
low complexity region 480 499 N/A INTRINSIC
low complexity region 700 718 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
low complexity region 794 815 N/A INTRINSIC
SAM 872 938 2.04e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000131445
SMART Domains Protein: ENSMUSP00000119137
Gene: ENSMUSG00000014329

DomainStartEndE-ValueType
SCOP:d1dtja_ 1 46 1e-2 SMART
Blast:KH 1 47 1e-22 BLAST
KH 51 124 6.24e-18 SMART
KH 203 273 1.25e-8 SMART
low complexity region 302 320 N/A INTRINSIC
low complexity region 365 385 N/A INTRINSIC
low complexity region 398 417 N/A INTRINSIC
low complexity region 618 636 N/A INTRINSIC
low complexity region 654 665 N/A INTRINSIC
low complexity region 712 733 N/A INTRINSIC
SAM 790 856 2.04e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000143791
SMART Domains Protein: ENSMUSP00000123201
Gene: ENSMUSG00000014329

DomainStartEndE-ValueType
KH 47 129 2.69e0 SMART
KH 133 206 6.24e-18 SMART
KH 285 355 1.25e-8 SMART
low complexity region 384 402 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
low complexity region 480 499 N/A INTRINSIC
low complexity region 700 718 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
low complexity region 794 815 N/A INTRINSIC
SAM 872 938 4.26e-12 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is active in regulating gene expression by modulating protein translation during embryonic development. Mouse studies identified the corresponding protein to be under strict control during cell differentiation and to be a maternally provided gene product. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous inactivation of this gene causes heteroxia, impaired nodal flow, ventricular septal defects, partial prenatal lethality and postnatal death due to renal failure. Chemically induced mutants develop kidney cysts and may show bulging abdomens, bile duct anomalies and cardiovascular defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,989,553 (GRCm39) probably benign Het
Adamts9 A G 6: 92,920,126 (GRCm39) V4A possibly damaging Het
AI837181 GGC GGCTGC 19: 5,475,260 (GRCm39) probably benign Het
Alk A G 17: 72,202,931 (GRCm39) Y1135H probably damaging Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,693,979 (GRCm39) probably benign Het
Ano3 A C 2: 110,527,381 (GRCm39) L609R probably benign Het
Bltp1 TTAT TTATTATTATTATTAGTAT 3: 37,104,906 (GRCm39) probably benign Het
Card6 T C 15: 5,129,624 (GRCm39) I591V probably benign Het
Ccdc121rt2 T A 5: 112,597,937 (GRCm39) N161K probably benign Het
Ccdc18 A G 5: 108,368,582 (GRCm39) N1235D probably benign Het
Cd109 TTAT TTATTTATTTATCTAT 9: 78,619,813 (GRCm39) probably benign Het
Cnpy3 CCT CCTGCT 17: 47,047,670 (GRCm39) probably benign Het
Col6a5 GCAGTC GCAGTCTCCAGTC 9: 105,755,796 (GRCm39) probably null Het
Cyb5r4 GACACACTGCCCAGGGA GACACACTGCCCAGGGATGTGACACACACACTGCCCAGGGA 9: 86,922,485 (GRCm39) probably benign Het
Cyp8b1 A T 9: 121,744,561 (GRCm39) M257K possibly damaging Het
Dbf4 A T 5: 8,447,985 (GRCm39) H408Q possibly damaging Het
Defb22 TTGCGGCA TTGCGGCAGAGCTGGCCTGTGCGGCA 2: 152,327,751 (GRCm39) probably benign Het
Ercc6l2 A T 13: 64,000,831 (GRCm39) T417S probably benign Het
Exd2 AGCCACAG A 12: 80,522,706 (GRCm39) probably null Het
Fam171b GC GCAGCATC 2: 83,643,239 (GRCm39) probably benign Het
Flvcr2 T A 12: 85,793,960 (GRCm39) L112Q probably damaging Het
Flywch1 GTG GTGGGGGGAGGCTACGTACTCACCCACTCCTTTTG 17: 23,981,149 (GRCm39) probably null Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 71,314,022 (GRCm39) probably benign Het
Garin5a CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGACGGCTGGATCCTGGATCACTGGGTCTGAGGGAGGA 7: 44,149,944 (GRCm39) probably null Het
Gm4884 C A 7: 40,690,233 (GRCm39) P43Q probably damaging Het
Grm8 A G 6: 27,363,779 (GRCm39) W579R probably damaging Het
Hsdl2 AG AGCAGCAGCCACAGCTGCCG 4: 59,610,657 (GRCm39) probably benign Het
Ivl CTGCTGCTGCTGCTGT C 3: 92,479,650 (GRCm39) probably benign Het
Kif18b T C 11: 102,803,192 (GRCm39) D506G probably benign Het
Krtap28-10 GCCACAGCCACCACA GCCACAGCCACCACATCCACAGCCACCACA 1: 83,019,995 (GRCm39) probably benign Het
Krtap28-10 AGCCAC AGCCACGGCCAC 1: 83,019,856 (GRCm39) probably benign Het
Lama1 C A 17: 68,088,057 (GRCm39) S1558R Het
Lcmt1 C CCGCGGGGCTT 7: 122,969,059 (GRCm39) probably null Het
Lmna A G 3: 88,391,361 (GRCm39) V494A probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,295,542 (GRCm39) probably null Het
Mboat7 T A 7: 3,694,856 (GRCm39) H52L probably damaging Het
Med12l CAG CAGAAG 3: 59,183,387 (GRCm39) probably benign Het
Morc2a T A 11: 3,626,191 (GRCm39) M225K probably benign Het
Mpdz G A 4: 81,211,829 (GRCm39) A1566V possibly damaging Het
Mpi T C 9: 57,455,924 (GRCm39) D186G probably benign Het
Mtmr12 C A 15: 12,261,984 (GRCm39) N386K probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 66,977,182 (GRCm39) probably null Het
Myo10 T A 15: 25,799,565 (GRCm39) M1376K probably damaging Het
Nbas C T 12: 13,329,409 (GRCm39) T118I possibly damaging Het
Nedd4l C T 18: 65,342,751 (GRCm39) R755C probably damaging Het
Nefh GACTTGGCCTCACCTGGG GACTTGGCCTCACCTGGGTACTTGGCCTCACCTGGG 11: 4,891,032 (GRCm39) probably benign Het
Numa1 T C 7: 101,648,987 (GRCm39) L906P probably damaging Het
Or6s1 G A 14: 51,308,469 (GRCm39) A127V probably damaging Het
Or7h8 T C 9: 20,124,190 (GRCm39) S182P probably benign Het
Otop2 G T 11: 115,214,492 (GRCm39) R83L probably benign Het
Pmm1 T A 15: 81,842,014 (GRCm39) Q62L probably damaging Het
Pramel16 C G 4: 143,675,478 (GRCm39) Q449H probably damaging Het
Ptprj A T 2: 90,301,514 (GRCm39) L206* probably null Het
Rassf6 TC TCTGCCTCACTCATGGTCCTGTAGAGCATTGGGGATCC 5: 90,756,800 (GRCm39) probably benign Het
Rps19 A AGAAAAT 7: 24,588,605 (GRCm39) probably benign Het
Rsrp1 T A 4: 134,651,266 (GRCm39) V10E unknown Het
Sh2d6 C T 6: 72,493,371 (GRCm39) probably null Het
Six4 TG T 12: 73,150,356 (GRCm39) probably null Het
Slc6a15 T A 10: 103,236,077 (GRCm39) V264D probably damaging Het
Snapc5 ATGGAAGAAGAGG A 9: 64,089,493 (GRCm39) probably benign Het
Sost A T 11: 101,854,958 (GRCm39) I117N probably damaging Het
Spmip5 A G 19: 58,777,726 (GRCm39) F28S probably damaging Het
Tbc1d22a AGGTGTGTG A 15: 86,183,975 (GRCm39) probably null Het
Tcaf1 C T 6: 42,656,107 (GRCm39) V290I probably benign Het
Tcof1 GCA GCACCA 18: 60,968,815 (GRCm39) probably benign Het
Tex55 T C 16: 38,648,363 (GRCm39) T249A probably benign Het
Tgfbr1 A G 4: 47,353,354 (GRCm39) I15V unknown Het
Tmem241 A T 18: 12,116,618 (GRCm39) L288Q probably damaging Het
Tnfrsf13b T G 11: 61,032,270 (GRCm39) V100G probably benign Het
Trim66 A G 7: 109,059,960 (GRCm39) S809P probably damaging Het
Tubb4a C G 17: 57,394,464 (GRCm39) G17A possibly damaging Het
Txndc16 A G 14: 45,406,795 (GRCm39) V220A probably benign Het
Zan T A 5: 137,389,982 (GRCm39) Q4830L unknown Het
Other mutations in Bicc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Bicc1 APN 10 70,796,987 (GRCm39) missense probably damaging 1.00
IGL01988:Bicc1 APN 10 70,792,006 (GRCm39) missense probably damaging 1.00
IGL02686:Bicc1 APN 10 70,779,190 (GRCm39) splice site probably benign
IGL02829:Bicc1 APN 10 70,794,710 (GRCm39) missense probably damaging 1.00
IGL03276:Bicc1 APN 10 70,789,268 (GRCm39) missense possibly damaging 0.76
IGL03354:Bicc1 APN 10 70,782,432 (GRCm39) missense probably benign 0.00
artemis UTSW 10 70,863,784 (GRCm39) missense probably damaging 0.99
Pebbles UTSW 10 70,783,730 (GRCm39) missense possibly damaging 0.95
PIT1430001:Bicc1 UTSW 10 70,793,511 (GRCm39) missense possibly damaging 0.94
R0095:Bicc1 UTSW 10 70,796,988 (GRCm39) missense probably damaging 1.00
R0142:Bicc1 UTSW 10 70,761,200 (GRCm39) missense probably damaging 1.00
R0184:Bicc1 UTSW 10 70,915,045 (GRCm39) missense probably benign
R0469:Bicc1 UTSW 10 70,915,045 (GRCm39) missense probably benign
R0485:Bicc1 UTSW 10 70,761,145 (GRCm39) missense probably damaging 0.96
R0520:Bicc1 UTSW 10 70,793,020 (GRCm39) missense probably damaging 0.96
R0884:Bicc1 UTSW 10 70,794,677 (GRCm39) missense probably damaging 1.00
R1678:Bicc1 UTSW 10 70,779,348 (GRCm39) missense probably damaging 1.00
R1892:Bicc1 UTSW 10 70,794,614 (GRCm39) missense probably damaging 1.00
R1943:Bicc1 UTSW 10 70,995,353 (GRCm39) missense probably damaging 1.00
R2220:Bicc1 UTSW 10 70,785,955 (GRCm39) missense probably damaging 1.00
R2240:Bicc1 UTSW 10 70,782,633 (GRCm39) critical splice donor site probably null
R2519:Bicc1 UTSW 10 70,766,474 (GRCm39) missense probably damaging 1.00
R4362:Bicc1 UTSW 10 70,779,204 (GRCm39) frame shift probably null
R4363:Bicc1 UTSW 10 70,779,204 (GRCm39) frame shift probably null
R4419:Bicc1 UTSW 10 70,782,804 (GRCm39) missense possibly damaging 0.73
R4697:Bicc1 UTSW 10 70,789,314 (GRCm39) missense possibly damaging 0.87
R4728:Bicc1 UTSW 10 70,771,661 (GRCm39) critical splice donor site probably null
R4765:Bicc1 UTSW 10 70,776,423 (GRCm39) missense probably damaging 1.00
R4838:Bicc1 UTSW 10 70,781,146 (GRCm39) missense possibly damaging 0.50
R5022:Bicc1 UTSW 10 70,783,713 (GRCm39) missense possibly damaging 0.79
R5023:Bicc1 UTSW 10 70,783,713 (GRCm39) missense possibly damaging 0.79
R5057:Bicc1 UTSW 10 70,783,713 (GRCm39) missense possibly damaging 0.79
R5082:Bicc1 UTSW 10 70,776,352 (GRCm39) missense probably benign 0.05
R5160:Bicc1 UTSW 10 70,768,066 (GRCm39) missense probably damaging 1.00
R5294:Bicc1 UTSW 10 70,783,730 (GRCm39) missense possibly damaging 0.95
R5639:Bicc1 UTSW 10 70,776,350 (GRCm39) missense probably damaging 1.00
R5749:Bicc1 UTSW 10 70,782,799 (GRCm39) missense probably benign 0.00
R6045:Bicc1 UTSW 10 70,792,911 (GRCm39) nonsense probably null
R6128:Bicc1 UTSW 10 70,776,313 (GRCm39) splice site probably null
R6277:Bicc1 UTSW 10 70,863,731 (GRCm39) missense possibly damaging 0.74
R6389:Bicc1 UTSW 10 70,794,752 (GRCm39) missense probably damaging 1.00
R7021:Bicc1 UTSW 10 70,796,978 (GRCm39) missense probably damaging 0.99
R7101:Bicc1 UTSW 10 70,766,483 (GRCm39) missense probably damaging 1.00
R7351:Bicc1 UTSW 10 70,783,730 (GRCm39) missense probably benign 0.18
R7352:Bicc1 UTSW 10 70,783,730 (GRCm39) missense probably benign 0.18
R7353:Bicc1 UTSW 10 70,783,730 (GRCm39) missense probably benign 0.18
R7366:Bicc1 UTSW 10 70,779,216 (GRCm39) missense probably benign 0.01
R7480:Bicc1 UTSW 10 70,779,306 (GRCm39) missense probably damaging 1.00
R7541:Bicc1 UTSW 10 70,782,434 (GRCm39) missense possibly damaging 0.82
R7544:Bicc1 UTSW 10 70,792,204 (GRCm39) missense possibly damaging 0.89
R7555:Bicc1 UTSW 10 70,792,121 (GRCm39) missense possibly damaging 0.75
R7663:Bicc1 UTSW 10 70,782,420 (GRCm39) missense probably benign
R7671:Bicc1 UTSW 10 70,792,997 (GRCm39) missense probably benign 0.01
R7747:Bicc1 UTSW 10 70,782,823 (GRCm39) missense probably benign
R8129:Bicc1 UTSW 10 70,915,033 (GRCm39) missense probably benign 0.01
R8270:Bicc1 UTSW 10 70,767,938 (GRCm39) missense probably damaging 0.99
R8525:Bicc1 UTSW 10 70,779,365 (GRCm39) missense possibly damaging 0.67
R8762:Bicc1 UTSW 10 70,779,216 (GRCm39) missense probably benign 0.03
R8849:Bicc1 UTSW 10 70,782,694 (GRCm39) missense probably benign 0.23
R9120:Bicc1 UTSW 10 70,776,862 (GRCm39) missense probably damaging 1.00
R9164:Bicc1 UTSW 10 70,781,094 (GRCm39) missense probably damaging 1.00
R9368:Bicc1 UTSW 10 70,785,917 (GRCm39) missense probably benign 0.13
R9452:Bicc1 UTSW 10 70,792,981 (GRCm39) missense probably damaging 0.99
R9497:Bicc1 UTSW 10 70,776,828 (GRCm39) critical splice donor site probably null
R9641:Bicc1 UTSW 10 70,863,772 (GRCm39) missense probably benign 0.01
R9672:Bicc1 UTSW 10 70,794,666 (GRCm39) missense probably damaging 1.00
X0028:Bicc1 UTSW 10 70,781,166 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTGAGTGCCCTTGACAGG -3'
(R):5'- AGACATTGTGTGGCATCGTC -3'

Sequencing Primer
(F):5'- CCTTGACAGGGAGGAATCAG -3'
(R):5'- CTCTGAGATGTCTACTTTGTTGAAC -3'
Posted On 2019-12-04