Incidental Mutation 'RF013:Slc6a15'
ID 603349
Institutional Source Beutler Lab
Gene Symbol Slc6a15
Ensembl Gene ENSMUSG00000019894
Gene Name solute carrier family 6 (neurotransmitter transporter), member 15
Synonyms v7-3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # RF013 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 103367783-103419377 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 103400216 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 264 (V264D)
Ref Sequence ENSEMBL: ENSMUSP00000073829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074204] [ENSMUST00000179636]
AlphaFold Q8BG16
Predicted Effect probably damaging
Transcript: ENSMUST00000074204
AA Change: V264D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000073829
Gene: ENSMUSG00000019894
AA Change: V264D

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:SNF 61 644 2.2e-229 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179636
AA Change: V264D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136676
Gene: ENSMUSG00000019894
AA Change: V264D

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:SNF 61 644 2.2e-229 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the solute carrier family 6 protein family which transports neutral amino acids. The encoded protein is thought to play a role in neuronal amino acid transport (PMID: 16185194) and may be associated with major depression (PMID: 21521612). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased synaptosome transport activities but exhibit no behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A G 19: 58,789,294 F28S probably damaging Het
4930435E12Rik T C 16: 38,828,001 T249A probably benign Het
4932438A13Rik TTAT TTATTATTATTATTAGTAT 3: 37,050,757 probably benign Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,905,096 probably benign Het
Adamts9 A G 6: 92,943,145 V4A possibly damaging Het
AI837181 GGC GGCTGC 19: 5,425,232 probably benign Het
Alk A G 17: 71,895,936 Y1135H probably damaging Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,560,926 probably benign Het
Ano3 A C 2: 110,697,036 L609R probably benign Het
Bicc1 A G 10: 70,935,830 probably null Het
Card6 T C 15: 5,100,142 I591V probably benign Het
Ccdc18 A G 5: 108,220,716 N1235D probably benign Het
Cd109 TTAT TTATTTATTTATCTAT 9: 78,712,531 probably benign Het
Cnpy3 CCT CCTGCT 17: 46,736,744 probably benign Het
Col6a5 GCAGTC GCAGTCTCCAGTC 9: 105,878,597 probably null Het
Cyb5r4 GACACACTGCCCAGGGA GACACACTGCCCAGGGATGTGACACACACACTGCCCAGGGA 9: 87,040,432 probably benign Het
Cyp8b1 A T 9: 121,915,495 M257K possibly damaging Het
Dbf4 A T 5: 8,397,985 H408Q possibly damaging Het
Defb22 TTGCGGCA TTGCGGCAGAGCTGGCCTGTGCGGCA 2: 152,485,831 probably benign Het
Ercc6l2 A T 13: 63,853,017 T417S probably benign Het
Exd2 AGCCACAG A 12: 80,475,932 probably null Het
Fam171b GC GCAGCATC 2: 83,812,895 probably benign Het
Fam71e1 CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGACGGCTGGATCCTGGATCACTGGGTCTGAGGGAGGA 7: 44,500,520 probably null Het
Flvcr2 T A 12: 85,747,186 L112Q probably damaging Het
Flywch1 GTG GTGGGGGGAGGCTACGTACTCACCCACTCCTTTTG 17: 23,762,175 probably null Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 72,270,416 probably benign Het
Gm4884 C A 7: 41,040,809 P43Q probably damaging Het
Gm6588 T A 5: 112,450,071 N161K probably benign Het
Grm8 A G 6: 27,363,780 W579R probably damaging Het
Hsdl2 AG AGCAGCAGCCACAGCTGCCG 4: 59,610,657 probably benign Het
Ivl CTGCTGCTGCTGCTGT C 3: 92,572,343 probably benign Het
Kif18b T C 11: 102,912,366 D506G probably benign Het
Krtap28-10 AGCCAC AGCCACGGCCAC 1: 83,042,135 probably benign Het
Krtap28-10 GCCACAGCCACCACA GCCACAGCCACCACATCCACAGCCACCACA 1: 83,042,274 probably benign Het
Lama1 C A 17: 67,781,062 S1558R Het
Lcmt1 C CCGCGGGGCTT 7: 123,369,836 probably null Het
Lmna A G 3: 88,484,054 V494A probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,388,260 probably null Het
Mboat7 T A 7: 3,691,857 H52L probably damaging Het
Med12l CAG CAGAAG 3: 59,275,966 probably benign Het
Morc2a T A 11: 3,676,191 M225K probably benign Het
Mpdz G A 4: 81,293,592 A1566V possibly damaging Het
Mpi T C 9: 57,548,641 D186G probably benign Het
Mtmr12 C A 15: 12,261,898 N386K probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myo10 T A 15: 25,799,479 M1376K probably damaging Het
Nbas C T 12: 13,279,408 T118I possibly damaging Het
Nedd4l C T 18: 65,209,680 R755C probably damaging Het
Nefh GACTTGGCCTCACCTGGG GACTTGGCCTCACCTGGGTACTTGGCCTCACCTGGG 11: 4,941,032 probably benign Het
Numa1 T C 7: 101,999,780 L906P probably damaging Het
Olfr750 G A 14: 51,071,012 A127V probably damaging Het
Olfr871 T C 9: 20,212,894 S182P probably benign Het
Otop2 G T 11: 115,323,666 R83L probably benign Het
Pmm1 T A 15: 81,957,813 Q62L probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Ptprj A T 2: 90,471,170 L206* probably null Het
Rassf6 TC TCTGCCTCACTCATGGTCCTGTAGAGCATTGGGGATCC 5: 90,608,941 probably benign Het
Rps19 A AGAAAAT 7: 24,889,180 probably benign Het
Rsrp1 T A 4: 134,923,955 V10E unknown Het
Sh2d6 C T 6: 72,516,388 probably null Het
Six4 TG T 12: 73,103,582 probably null Het
Snapc5 ATGGAAGAAGAGG A 9: 64,182,211 probably benign Het
Sost A T 11: 101,964,132 I117N probably damaging Het
Tbc1d22a AGGTGTGTG A 15: 86,299,774 probably null Het
Tcaf1 C T 6: 42,679,173 V290I probably benign Het
Tcof1 GCA GCACCA 18: 60,835,743 probably benign Het
Tgfbr1 A G 4: 47,353,354 I15V unknown Het
Tmem241 A T 18: 11,983,561 L288Q probably damaging Het
Tnfrsf13b T G 11: 61,141,444 V100G probably benign Het
Trim66 A G 7: 109,460,753 S809P probably damaging Het
Tubb4a C G 17: 57,087,464 G17A possibly damaging Het
Txndc16 A G 14: 45,169,338 V220A probably benign Het
Zan T A 5: 137,391,720 Q4830L unknown Het
Other mutations in Slc6a15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Slc6a15 APN 10 103389141 missense probably benign
IGL01320:Slc6a15 APN 10 103404745 missense probably benign 0.00
IGL01924:Slc6a15 APN 10 103404825 splice site probably null
IGL02066:Slc6a15 APN 10 103416658 missense probably damaging 0.98
IGL02164:Slc6a15 APN 10 103418222 missense probably benign 0.01
IGL02551:Slc6a15 APN 10 103404275 splice site probably benign
IGL02744:Slc6a15 APN 10 103418033 missense probably benign 0.03
R0028:Slc6a15 UTSW 10 103416680 missense probably benign 0.00
R0143:Slc6a15 UTSW 10 103418068 missense probably benign 0.02
R0158:Slc6a15 UTSW 10 103389347 splice site probably benign
R0165:Slc6a15 UTSW 10 103409809 missense probably null 0.04
R0349:Slc6a15 UTSW 10 103418225 missense probably benign 0.06
R0383:Slc6a15 UTSW 10 103418053 missense probably damaging 1.00
R0614:Slc6a15 UTSW 10 103404352 nonsense probably null
R0784:Slc6a15 UTSW 10 103416800 splice site probably benign
R0944:Slc6a15 UTSW 10 103409796 missense probably benign 0.01
R1795:Slc6a15 UTSW 10 103400260 missense probably benign
R1882:Slc6a15 UTSW 10 103395064 missense probably benign 0.20
R2061:Slc6a15 UTSW 10 103409734 missense probably benign 0.20
R2156:Slc6a15 UTSW 10 103393408 missense probably damaging 1.00
R2358:Slc6a15 UTSW 10 103416785 missense probably benign 0.00
R2849:Slc6a15 UTSW 10 103404691 missense probably benign 0.01
R2921:Slc6a15 UTSW 10 103418387 missense probably damaging 0.99
R3709:Slc6a15 UTSW 10 103393414 missense probably benign 0.00
R4532:Slc6a15 UTSW 10 103409787 missense possibly damaging 0.69
R4825:Slc6a15 UTSW 10 103418060 missense probably benign 0.05
R4909:Slc6a15 UTSW 10 103404414 missense probably damaging 1.00
R5112:Slc6a15 UTSW 10 103389226 missense probably benign
R5320:Slc6a15 UTSW 10 103408206 missense probably damaging 1.00
R5364:Slc6a15 UTSW 10 103393508 missense probably damaging 0.99
R6305:Slc6a15 UTSW 10 103389170 missense probably benign 0.31
R6348:Slc6a15 UTSW 10 103404367 missense probably damaging 1.00
R6729:Slc6a15 UTSW 10 103393914 missense probably damaging 0.99
R6781:Slc6a15 UTSW 10 103395067 missense probably damaging 0.99
R7409:Slc6a15 UTSW 10 103408302 missense probably benign
R7549:Slc6a15 UTSW 10 103389137 missense probably benign
R7660:Slc6a15 UTSW 10 103393380 splice site probably null
R7839:Slc6a15 UTSW 10 103404799 missense probably benign
R7948:Slc6a15 UTSW 10 103404295 missense possibly damaging 0.95
R8278:Slc6a15 UTSW 10 103394029 critical splice donor site probably null
R8379:Slc6a15 UTSW 10 103389187 missense probably benign 0.00
R8685:Slc6a15 UTSW 10 103409695 missense possibly damaging 0.68
R8712:Slc6a15 UTSW 10 103389251 missense probably damaging 1.00
R8719:Slc6a15 UTSW 10 103404315 missense probably damaging 0.99
R8832:Slc6a15 UTSW 10 103389318 missense probably damaging 1.00
R8940:Slc6a15 UTSW 10 103393496 missense probably damaging 1.00
R8978:Slc6a15 UTSW 10 103395092 nonsense probably null
R9050:Slc6a15 UTSW 10 103416655 missense possibly damaging 0.88
R9113:Slc6a15 UTSW 10 103400279 missense probably damaging 1.00
R9242:Slc6a15 UTSW 10 103393545 nonsense probably null
R9493:Slc6a15 UTSW 10 103393416 missense probably benign 0.35
R9529:Slc6a15 UTSW 10 103404722 missense probably benign 0.14
R9532:Slc6a15 UTSW 10 103404472 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTCAAGTGAGATTTAAAGAAGGCTG -3'
(R):5'- AACCCACTTTTCTGGAGAGG -3'

Sequencing Primer
(F):5'- GGCTGAATCCAGAACAGTCTTC -3'
(R):5'- CCACTTTTCTGGAGAGGTTAATATAC -3'
Posted On 2019-12-04