Incidental Mutation 'RF013:Nefh'
ID 603351
Institutional Source Beutler Lab
Gene Symbol Nefh
Ensembl Gene ENSMUSG00000020396
Gene Name neurofilament, heavy polypeptide
Synonyms NF-H, NEFH, NF200
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # RF013 (G1)
Quality Score 217.468
Status Not validated
Chromosome 11
Chromosomal Location 4938754-4948064 bp(-) (GRCm38)
Type of Mutation small insertion (6 aa in frame mutation)
DNA Base Change (assembly) GACTTGGCCTCACCTGGG to GACTTGGCCTCACCTGGGTACTTGGCCTCACCTGGG at 4941032 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093369]
AlphaFold P19246
Predicted Effect probably benign
Transcript: ENSMUST00000093369
SMART Domains Protein: ENSMUSP00000091061
Gene: ENSMUSG00000020396

DomainStartEndE-ValueType
low complexity region 32 46 N/A INTRINSIC
low complexity region 49 64 N/A INTRINSIC
Filament 94 410 1.45e-109 SMART
low complexity region 470 515 N/A INTRINSIC
Pfam:DUF1388 519 545 1.8e-14 PFAM
Pfam:DUF1388 536 562 5.8e-15 PFAM
Pfam:DUF1388 542 569 2.7e-12 PFAM
Pfam:DUF1388 578 611 9.7e-10 PFAM
Pfam:DUF1388 602 629 4.9e-14 PFAM
Pfam:DUF1388 608 635 4.7e-14 PFAM
Pfam:DUF1388 626 653 1.4e-13 PFAM
Pfam:DUF1388 632 659 2.5e-13 PFAM
Pfam:DUF1388 656 683 4.4e-14 PFAM
Pfam:DUF1388 680 706 1.5e-12 PFAM
Pfam:DUF1388 700 730 5e-12 PFAM
Pfam:DUF1388 728 755 7.9e-14 PFAM
Pfam:DUF1388 752 779 4.7e-14 PFAM
Pfam:DUF1388 779 800 1.9e-9 PFAM
low complexity region 816 829 N/A INTRINSIC
low complexity region 858 948 N/A INTRINSIC
low complexity region 949 968 N/A INTRINSIC
low complexity region 976 1039 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurofilaments are type IV intermediate filament heteropolymers composed of light, medium, and heavy chains. Neurofilaments comprise the axoskeleton and functionally maintain neuronal caliber. They may also play a role in intracellular transport to axons and dendrites. This gene encodes the heavy neurofilament protein. This protein is commonly used as a biomarker of neuronal damage and susceptibility to amyotrophic lateral sclerosis (ALS) has been associated with mutations in this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased axon diameter and transport. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A G 19: 58,789,294 F28S probably damaging Het
4930435E12Rik T C 16: 38,828,001 T249A probably benign Het
4932438A13Rik TTAT TTATTATTATTATTAGTAT 3: 37,050,757 probably benign Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,905,096 probably benign Het
Adamts9 A G 6: 92,943,145 V4A possibly damaging Het
AI837181 GGC GGCTGC 19: 5,425,232 probably benign Het
Alk A G 17: 71,895,936 Y1135H probably damaging Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,560,926 probably benign Het
Ano3 A C 2: 110,697,036 L609R probably benign Het
Bicc1 A G 10: 70,935,830 probably null Het
Card6 T C 15: 5,100,142 I591V probably benign Het
Ccdc18 A G 5: 108,220,716 N1235D probably benign Het
Cd109 TTAT TTATTTATTTATCTAT 9: 78,712,531 probably benign Het
Cnpy3 CCT CCTGCT 17: 46,736,744 probably benign Het
Col6a5 GCAGTC GCAGTCTCCAGTC 9: 105,878,597 probably null Het
Cyb5r4 GACACACTGCCCAGGGA GACACACTGCCCAGGGATGTGACACACACACTGCCCAGGGA 9: 87,040,432 probably benign Het
Cyp8b1 A T 9: 121,915,495 M257K possibly damaging Het
Dbf4 A T 5: 8,397,985 H408Q possibly damaging Het
Defb22 TTGCGGCA TTGCGGCAGAGCTGGCCTGTGCGGCA 2: 152,485,831 probably benign Het
Ercc6l2 A T 13: 63,853,017 T417S probably benign Het
Exd2 AGCCACAG A 12: 80,475,932 probably null Het
Fam171b GC GCAGCATC 2: 83,812,895 probably benign Het
Fam71e1 CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGACGGCTGGATCCTGGATCACTGGGTCTGAGGGAGGA 7: 44,500,520 probably null Het
Flvcr2 T A 12: 85,747,186 L112Q probably damaging Het
Flywch1 GTG GTGGGGGGAGGCTACGTACTCACCCACTCCTTTTG 17: 23,762,175 probably null Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 72,270,416 probably benign Het
Gm4884 C A 7: 41,040,809 P43Q probably damaging Het
Gm6588 T A 5: 112,450,071 N161K probably benign Het
Grm8 A G 6: 27,363,780 W579R probably damaging Het
Hsdl2 AG AGCAGCAGCCACAGCTGCCG 4: 59,610,657 probably benign Het
Ivl CTGCTGCTGCTGCTGT C 3: 92,572,343 probably benign Het
Kif18b T C 11: 102,912,366 D506G probably benign Het
Krtap28-10 AGCCAC AGCCACGGCCAC 1: 83,042,135 probably benign Het
Krtap28-10 GCCACAGCCACCACA GCCACAGCCACCACATCCACAGCCACCACA 1: 83,042,274 probably benign Het
Lama1 C A 17: 67,781,062 S1558R Het
Lcmt1 C CCGCGGGGCTT 7: 123,369,836 probably null Het
Lmna A G 3: 88,484,054 V494A probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,388,260 probably null Het
Mboat7 T A 7: 3,691,857 H52L probably damaging Het
Med12l CAG CAGAAG 3: 59,275,966 probably benign Het
Morc2a T A 11: 3,676,191 M225K probably benign Het
Mpdz G A 4: 81,293,592 A1566V possibly damaging Het
Mpi T C 9: 57,548,641 D186G probably benign Het
Mtmr12 C A 15: 12,261,898 N386K probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myo10 T A 15: 25,799,479 M1376K probably damaging Het
Nbas C T 12: 13,279,408 T118I possibly damaging Het
Nedd4l C T 18: 65,209,680 R755C probably damaging Het
Numa1 T C 7: 101,999,780 L906P probably damaging Het
Olfr750 G A 14: 51,071,012 A127V probably damaging Het
Olfr871 T C 9: 20,212,894 S182P probably benign Het
Otop2 G T 11: 115,323,666 R83L probably benign Het
Pmm1 T A 15: 81,957,813 Q62L probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Ptprj A T 2: 90,471,170 L206* probably null Het
Rassf6 TC TCTGCCTCACTCATGGTCCTGTAGAGCATTGGGGATCC 5: 90,608,941 probably benign Het
Rps19 A AGAAAAT 7: 24,889,180 probably benign Het
Rsrp1 T A 4: 134,923,955 V10E unknown Het
Sh2d6 C T 6: 72,516,388 probably null Het
Six4 TG T 12: 73,103,582 probably null Het
Slc6a15 T A 10: 103,400,216 V264D probably damaging Het
Snapc5 ATGGAAGAAGAGG A 9: 64,182,211 probably benign Het
Sost A T 11: 101,964,132 I117N probably damaging Het
Tbc1d22a AGGTGTGTG A 15: 86,299,774 probably null Het
Tcaf1 C T 6: 42,679,173 V290I probably benign Het
Tcof1 GCA GCACCA 18: 60,835,743 probably benign Het
Tgfbr1 A G 4: 47,353,354 I15V unknown Het
Tmem241 A T 18: 11,983,561 L288Q probably damaging Het
Tnfrsf13b T G 11: 61,141,444 V100G probably benign Het
Trim66 A G 7: 109,460,753 S809P probably damaging Het
Tubb4a C G 17: 57,087,464 G17A possibly damaging Het
Txndc16 A G 14: 45,169,338 V220A probably benign Het
Zan T A 5: 137,391,720 Q4830L unknown Het
Other mutations in Nefh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02931:Nefh APN 11 4941356 missense possibly damaging 0.71
IGL03025:Nefh APN 11 4945289 missense probably damaging 0.99
FR4340:Nefh UTSW 11 4941033 small insertion probably benign
FR4340:Nefh UTSW 11 4941038 small insertion probably benign
FR4340:Nefh UTSW 11 4941040 small insertion probably benign
R0041:Nefh UTSW 11 4945184 missense possibly damaging 0.92
R0149:Nefh UTSW 11 4940799 missense probably benign 0.39
R0361:Nefh UTSW 11 4940799 missense probably benign 0.39
R0531:Nefh UTSW 11 4940240 missense probably damaging 1.00
R1340:Nefh UTSW 11 4941002 small insertion probably benign
R1349:Nefh UTSW 11 4941010 small insertion probably benign
R1469:Nefh UTSW 11 4940066 missense probably benign 0.20
R1469:Nefh UTSW 11 4940066 missense probably benign 0.20
R1564:Nefh UTSW 11 4939878 missense unknown
R2165:Nefh UTSW 11 4943872 missense probably damaging 1.00
R2417:Nefh UTSW 11 4939479 missense unknown
R2906:Nefh UTSW 11 4940216 missense probably benign 0.15
R3750:Nefh UTSW 11 4939937 missense probably benign 0.33
R4298:Nefh UTSW 11 4940066 missense probably benign
R4462:Nefh UTSW 11 4941015 missense probably damaging 0.98
R4713:Nefh UTSW 11 4939656 missense unknown
R4878:Nefh UTSW 11 4941333 missense probably damaging 0.98
R5423:Nefh UTSW 11 4940985 missense possibly damaging 0.59
R5648:Nefh UTSW 11 4945233 missense probably damaging 1.00
R5893:Nefh UTSW 11 4941323 missense probably damaging 1.00
R6459:Nefh UTSW 11 4939551 missense unknown
R7583:Nefh UTSW 11 4941089 missense probably damaging 0.96
R8557:Nefh UTSW 11 4941233 missense probably damaging 0.98
R8925:Nefh UTSW 11 4940530 small deletion probably benign
R8982:Nefh UTSW 11 4947549 missense probably damaging 1.00
R9101:Nefh UTSW 11 4940925 missense probably damaging 0.97
R9291:Nefh UTSW 11 4940871 missense probably benign 0.39
R9576:Nefh UTSW 11 4941222 missense possibly damaging 0.91
R9616:Nefh UTSW 11 4939443 nonsense probably null
R9709:Nefh UTSW 11 4940042 missense probably benign 0.44
R9781:Nefh UTSW 11 4945271 missense probably damaging 1.00
RF001:Nefh UTSW 11 4941030 small insertion probably benign
RF002:Nefh UTSW 11 4941047 small insertion probably benign
RF002:Nefh UTSW 11 4941050 small insertion probably benign
RF009:Nefh UTSW 11 4940997 small insertion probably benign
RF012:Nefh UTSW 11 4941030 small insertion probably benign
RF012:Nefh UTSW 11 4941032 small insertion probably benign
RF012:Nefh UTSW 11 4941055 small insertion probably benign
RF016:Nefh UTSW 11 4941022 small insertion probably benign
RF016:Nefh UTSW 11 4941023 small insertion probably benign
RF025:Nefh UTSW 11 4941003 small insertion probably benign
RF025:Nefh UTSW 11 4941029 small insertion probably benign
RF028:Nefh UTSW 11 4941012 small insertion probably benign
RF028:Nefh UTSW 11 4941029 small insertion probably benign
RF033:Nefh UTSW 11 4941029 frame shift probably null
RF033:Nefh UTSW 11 4941039 small insertion probably benign
RF035:Nefh UTSW 11 4941039 small insertion probably benign
RF036:Nefh UTSW 11 4941010 small insertion probably benign
RF036:Nefh UTSW 11 4941016 small insertion probably benign
RF036:Nefh UTSW 11 4941036 small insertion probably benign
RF036:Nefh UTSW 11 4941048 small insertion probably benign
RF037:Nefh UTSW 11 4940999 small insertion probably benign
RF037:Nefh UTSW 11 4941046 small insertion probably benign
RF037:Nefh UTSW 11 4941054 small insertion probably benign
RF038:Nefh UTSW 11 4941012 small insertion probably benign
RF038:Nefh UTSW 11 4941018 small insertion probably benign
RF038:Nefh UTSW 11 4941019 small insertion probably benign
RF038:Nefh UTSW 11 4941027 small insertion probably benign
RF038:Nefh UTSW 11 4941029 small insertion probably benign
RF038:Nefh UTSW 11 4941040 small insertion probably benign
RF039:Nefh UTSW 11 4941007 small insertion probably benign
RF041:Nefh UTSW 11 4941039 small insertion probably benign
RF043:Nefh UTSW 11 4941016 small insertion probably benign
RF044:Nefh UTSW 11 4941016 small insertion probably benign
RF044:Nefh UTSW 11 4941021 small insertion probably benign
RF044:Nefh UTSW 11 4941023 small insertion probably benign
RF047:Nefh UTSW 11 4941038 small insertion probably benign
RF048:Nefh UTSW 11 4941003 small insertion probably benign
RF048:Nefh UTSW 11 4941007 small insertion probably benign
RF049:Nefh UTSW 11 4940997 small insertion probably benign
RF051:Nefh UTSW 11 4941054 small insertion probably benign
RF053:Nefh UTSW 11 4941014 nonsense probably null
RF054:Nefh UTSW 11 4941048 small insertion probably benign
RF055:Nefh UTSW 11 4941004 small insertion probably benign
RF058:Nefh UTSW 11 4941021 small insertion probably benign
RF060:Nefh UTSW 11 4941050 small insertion probably benign
RF060:Nefh UTSW 11 4941052 small insertion probably benign
RF062:Nefh UTSW 11 4941028 small insertion probably benign
T0975:Nefh UTSW 11 4940151 missense probably benign 0.00
Z1186:Nefh UTSW 11 4940530 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- ACTGTAGCTGGAGACTTGGG -3'
(R):5'- ATTGGCTTTGGTCCGAGTCC -3'

Sequencing Primer
(F):5'- ACTTGGGCTCAGCTGGTGAC -3'
(R):5'- TCTTACTGAAGGACTCCCAAAAATTC -3'
Posted On 2019-12-04