Incidental Mutation 'RF013:Tnfrsf13b'
ID 603352
Institutional Source Beutler Lab
Gene Symbol Tnfrsf13b
Ensembl Gene ENSMUSG00000010142
Gene Name tumor necrosis factor receptor superfamily, member 13b
Synonyms Taci, 1200009E08Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.071) question?
Stock # RF013 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 61017581-61040198 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 61032270 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 100 (V100G)
Ref Sequence ENSEMBL: ENSMUSP00000010286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010286] [ENSMUST00000101103] [ENSMUST00000139422] [ENSMUST00000146033]
AlphaFold Q9ET35
Predicted Effect probably benign
Transcript: ENSMUST00000010286
AA Change: V100G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000010286
Gene: ENSMUSG00000010142
AA Change: V100G

internal_repeat_1 6 39 6.78e-5 PROSPERO
Pfam:TACI-CRD2 41 79 1.7e-24 PFAM
transmembrane domain 126 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101103
AA Change: V100G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000098662
Gene: ENSMUSG00000010142
AA Change: V100G

internal_repeat_1 6 39 6.78e-5 PROSPERO
Pfam:TACI-CRD2 41 81 2.6e-33 PFAM
transmembrane domain 126 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139422
AA Change: V100G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116175
Gene: ENSMUSG00000010142
AA Change: V100G

internal_repeat_1 6 39 1.03e-5 PROSPERO
Pfam:TACI-CRD2 41 81 9.6e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146033
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a lymphocyte-specific member of the tumor necrosis factor (TNF) receptor superfamily. It interacts with calcium-modulator and cyclophilin ligand (CAML). The protein induces activation of the transcription factors NFAT, AP1, and NF-kappa-B and plays a crucial role in humoral immunity by interacting with a TNF ligand. This gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice show increased B cell numbers and splenomegaly. Homozygotes for a null allele show impaired T cell-independent immune responses and isotype switching. Homozygotes for another null allele develop lymphoproliferation and fatal autoimmune nephritis with high titers of autoantibodies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,989,553 (GRCm39) probably benign Het
Adamts9 A G 6: 92,920,126 (GRCm39) V4A possibly damaging Het
AI837181 GGC GGCTGC 19: 5,475,260 (GRCm39) probably benign Het
Alk A G 17: 72,202,931 (GRCm39) Y1135H probably damaging Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,693,979 (GRCm39) probably benign Het
Ano3 A C 2: 110,527,381 (GRCm39) L609R probably benign Het
Bicc1 A G 10: 70,771,660 (GRCm39) probably null Het
Bltp1 TTAT TTATTATTATTATTAGTAT 3: 37,104,906 (GRCm39) probably benign Het
Card6 T C 15: 5,129,624 (GRCm39) I591V probably benign Het
Ccdc121rt2 T A 5: 112,597,937 (GRCm39) N161K probably benign Het
Ccdc18 A G 5: 108,368,582 (GRCm39) N1235D probably benign Het
Cd109 TTAT TTATTTATTTATCTAT 9: 78,619,813 (GRCm39) probably benign Het
Cnpy3 CCT CCTGCT 17: 47,047,670 (GRCm39) probably benign Het
Col6a5 GCAGTC GCAGTCTCCAGTC 9: 105,755,796 (GRCm39) probably null Het
Cyp8b1 A T 9: 121,744,561 (GRCm39) M257K possibly damaging Het
Dbf4 A T 5: 8,447,985 (GRCm39) H408Q possibly damaging Het
Defb22 TTGCGGCA TTGCGGCAGAGCTGGCCTGTGCGGCA 2: 152,327,751 (GRCm39) probably benign Het
Ercc6l2 A T 13: 64,000,831 (GRCm39) T417S probably benign Het
Exd2 AGCCACAG A 12: 80,522,706 (GRCm39) probably null Het
Fam171b GC GCAGCATC 2: 83,643,239 (GRCm39) probably benign Het
Flvcr2 T A 12: 85,793,960 (GRCm39) L112Q probably damaging Het
Flywch1 GTG GTGGGGGGAGGCTACGTACTCACCCACTCCTTTTG 17: 23,981,149 (GRCm39) probably null Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 71,314,022 (GRCm39) probably benign Het
Gm4884 C A 7: 40,690,233 (GRCm39) P43Q probably damaging Het
Grm8 A G 6: 27,363,779 (GRCm39) W579R probably damaging Het
Hsdl2 AG AGCAGCAGCCACAGCTGCCG 4: 59,610,657 (GRCm39) probably benign Het
Ivl CTGCTGCTGCTGCTGT C 3: 92,479,650 (GRCm39) probably benign Het
Kif18b T C 11: 102,803,192 (GRCm39) D506G probably benign Het
Krtap28-10 AGCCAC AGCCACGGCCAC 1: 83,019,856 (GRCm39) probably benign Het
Krtap28-10 GCCACAGCCACCACA GCCACAGCCACCACATCCACAGCCACCACA 1: 83,019,995 (GRCm39) probably benign Het
Lama1 C A 17: 68,088,057 (GRCm39) S1558R Het
Lcmt1 C CCGCGGGGCTT 7: 122,969,059 (GRCm39) probably null Het
Lmna A G 3: 88,391,361 (GRCm39) V494A probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,295,542 (GRCm39) probably null Het
Mboat7 T A 7: 3,694,856 (GRCm39) H52L probably damaging Het
Med12l CAG CAGAAG 3: 59,183,387 (GRCm39) probably benign Het
Morc2a T A 11: 3,626,191 (GRCm39) M225K probably benign Het
Mpdz G A 4: 81,211,829 (GRCm39) A1566V possibly damaging Het
Mpi T C 9: 57,455,924 (GRCm39) D186G probably benign Het
Mtmr12 C A 15: 12,261,984 (GRCm39) N386K probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 66,977,182 (GRCm39) probably null Het
Myo10 T A 15: 25,799,565 (GRCm39) M1376K probably damaging Het
Nbas C T 12: 13,329,409 (GRCm39) T118I possibly damaging Het
Nedd4l C T 18: 65,342,751 (GRCm39) R755C probably damaging Het
Numa1 T C 7: 101,648,987 (GRCm39) L906P probably damaging Het
Or6s1 G A 14: 51,308,469 (GRCm39) A127V probably damaging Het
Or7h8 T C 9: 20,124,190 (GRCm39) S182P probably benign Het
Otop2 G T 11: 115,214,492 (GRCm39) R83L probably benign Het
Pmm1 T A 15: 81,842,014 (GRCm39) Q62L probably damaging Het
Pramel16 C G 4: 143,675,478 (GRCm39) Q449H probably damaging Het
Ptprj A T 2: 90,301,514 (GRCm39) L206* probably null Het
Rassf6 TC TCTGCCTCACTCATGGTCCTGTAGAGCATTGGGGATCC 5: 90,756,800 (GRCm39) probably benign Het
Rps19 A AGAAAAT 7: 24,588,605 (GRCm39) probably benign Het
Rsrp1 T A 4: 134,651,266 (GRCm39) V10E unknown Het
Sh2d6 C T 6: 72,493,371 (GRCm39) probably null Het
Six4 TG T 12: 73,150,356 (GRCm39) probably null Het
Slc6a15 T A 10: 103,236,077 (GRCm39) V264D probably damaging Het
Snapc5 ATGGAAGAAGAGG A 9: 64,089,493 (GRCm39) probably benign Het
Sost A T 11: 101,854,958 (GRCm39) I117N probably damaging Het
Spmip5 A G 19: 58,777,726 (GRCm39) F28S probably damaging Het
Tbc1d22a AGGTGTGTG A 15: 86,183,975 (GRCm39) probably null Het
Tcaf1 C T 6: 42,656,107 (GRCm39) V290I probably benign Het
Tcof1 GCA GCACCA 18: 60,968,815 (GRCm39) probably benign Het
Tex55 T C 16: 38,648,363 (GRCm39) T249A probably benign Het
Tgfbr1 A G 4: 47,353,354 (GRCm39) I15V unknown Het
Tmem241 A T 18: 12,116,618 (GRCm39) L288Q probably damaging Het
Trim66 A G 7: 109,059,960 (GRCm39) S809P probably damaging Het
Tubb4a C G 17: 57,394,464 (GRCm39) G17A possibly damaging Het
Txndc16 A G 14: 45,406,795 (GRCm39) V220A probably benign Het
Zan T A 5: 137,389,982 (GRCm39) Q4830L unknown Het
Other mutations in Tnfrsf13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01690:Tnfrsf13b APN 11 61,032,146 (GRCm39) missense possibly damaging 0.51
R0523:Tnfrsf13b UTSW 11 61,038,413 (GRCm39) missense probably benign 0.33
R2297:Tnfrsf13b UTSW 11 61,038,271 (GRCm39) missense probably benign
R2517:Tnfrsf13b UTSW 11 61,032,302 (GRCm39) missense probably benign 0.27
R4298:Tnfrsf13b UTSW 11 61,031,643 (GRCm39) splice site probably null
R4299:Tnfrsf13b UTSW 11 61,031,643 (GRCm39) splice site probably null
R4454:Tnfrsf13b UTSW 11 61,032,264 (GRCm39) missense probably benign 0.33
R4931:Tnfrsf13b UTSW 11 61,031,763 (GRCm39) missense possibly damaging 0.66
R5416:Tnfrsf13b UTSW 11 61,037,849 (GRCm39) splice site probably null
R7995:Tnfrsf13b UTSW 11 61,031,742 (GRCm39) nonsense probably null
R8531:Tnfrsf13b UTSW 11 61,031,777 (GRCm39) critical splice donor site probably null
R8790:Tnfrsf13b UTSW 11 61,038,350 (GRCm39) missense possibly damaging 0.53
R8858:Tnfrsf13b UTSW 11 61,038,363 (GRCm39) missense possibly damaging 0.73
Z1176:Tnfrsf13b UTSW 11 61,037,836 (GRCm39) missense possibly damaging 0.53
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04